Hybrid chitosan/gelatin/nanohydroxyapatite scaffolds promote odontogenic differentiation of dental pulp stem cells and in vitro biomineralization



Hybrid chitosan/gelatin/nanohydroxyapatite scaffolds promote odontogenic differentiation of dental pulp stem cells and in vitro biomineralization




Dental Materials, 2021-01-01, Volume 37, Issue 1, Pages e23-e36, Copyright © 2020 The Academy of Dental Materials


Abstract

Objective

Hybrid chitosan/gelatin/nanohydroxyapatite (CS/Gel/nHA) scaffolds have attracted considerable interest in tissue engineering (TE) of mineralized tissues. The present study aimed to investigate the potential of CS/Gel/nHA scaffolds loaded with dental pulp stem cells (DPSCs) to induce odontogenic differentiation and in vitro biomineralization.

Methods

CS/Gel/nHA scaffolds were synthesized by freeze-drying, seeded with DPSCs, and characterized with flow cytometry. Scanning Electron Microscopy (SEM), live/dead staining, and MTT assays were used to evaluate cell morphology and viability; real-time PCR for odontogenesis-related gene expression analysis; SEM-EDS (Energy Dispersive X-ray spectroscopy), and X-ray Diffraction analysis (XRD) for structural and chemical characterization of the mineralized constructs, respectively.

Results

CS/Gel/nHA scaffolds supported viability and proliferation of DPSCs over 14 days in culture. Gene expression patterns indicated pronounced odontogenic shift of DPSCs, evidenced by upregulation of DSPP, BMP-2, ALP, and the transcription factors RunX2 and Osterix . SEM-EDS showed the production of a nanocrystalline mineralized matrix inside the cell-based and - to a lesser extent - the cell-free constructs, with a time-dependent production of net-like nanocrystals (appr. 25−30 nm in diameter). XRD analysis gave the crystallite size ( D = 50 nm) but could not distinguish between the initially incorporated and the biologically produced nHA.

Significance

This is the first study validating the potential of CS/Gel/nHA scaffolds to support viability and proliferation of DPSCs, and to provide a biomimetic microenvironment favoring odontogenic differentiation and in vitro biomineralization without the addition of any inductive factors, including dexamethasone and/or growth/morphogenetic factors. These results reveal a promising strategy towards TE of mineralized dental tissues.

Introduction

Numerous studies have provided evidence that restorative dental procedures are closely linked to several biological and technical complications, as well as adverse reactions, leading to unpredictable therapeutic efficiency [ ]. The latter justifies the rationale for pursuing regeneration approaches for dentin – the bulk of a tooth's structure – as the ultimate goal of modern dental tissue engineering (TE) strategies. In recent years, TE has achieved regeneration of the dentin/pulp complex in preclinical [ , ] and clinical models [ ] or even regeneration of bio-roots [ , ] and fully functional teeth in animal models [ , ].

TE aims to regenerate tissues and organs by using cell and biomaterial-based approaches. Towards this direction, the selection of suitable scaffold materials, providing the three-dimensional microenvironment mimicking the extracellular matrix (ECM), is of crucial importance. Different scaffold materials have been employed for mineralized tissue regeneration applications, including porous bioceramics ( e.g. hydroxyapatite/HA, and β-tricalcium phosphate/β-TCP), natural molecules ( e.g. collagen and chitosan), as well as synthetic polymers ( e.g. polyglycolic acid/ PGA and polylactic acid/ PLA) [ , ]. Each material offers variable chemical and structural characteristics, degradation properties, and versatility in handling; nevertheless, only a few have been used effectively for the targeted regeneration of mineralized dental tissues [ ].

Dentin is a complex structure comprising various tissues with different functions and specificities regarding extracellular matrix (ECM) content, and crystallographic profiles. It includes tubular dentin (orthodentin) that represents the main structure produced during dentinogenesis by meta-mitotic odontoblasts, with cell bodies located outside the predentin/dentin layer at the pulp periphery and cell processes extending inside the dentin tubules. After tooth eruption, response to mild trauma ( e.g. carious decay or abrasion), leads to the production of the reactionary (tertiary) dentin by the odontoblastic or subjacent pre-odontoblastic (Hoel’s) cells, that may appear either as tubular or atubular orthodentin or as less organized bone-like tissue (osteodentin). In case of severe trauma (deep caries, restorative procedures etc. ) leading to disruption of the odontoblastic layer, a less mineralized, bone-like tissue called reparative dentin (osteodentin), is produced as a result of the activity of pulp stem/progenitor cells [ ]. Dentin primarily consists of a mineral phase (70 wt %), an organic phase (20 wt %), and water (10 wt %). The organic phase primarily comprises collagen I (90% in intertubular dentin), and other non-collagenous proteins (NCP), including the Small Integrin-Binding Ligand N-linked Glycoproteins (SIBLINGs), such as DSPP, DMP-1, BSP, OPN and MEPE [ ], the Small Leucine-rich proteoglycans (SLRPS), such as biglycan, and decorin and fibromodulin, non-phosphorylated proteins, such as osteocalcin, growth factors, enzymes, phospholipids, proteolipids etc. Despite some similarities in structure, dentin – in contrast to bone – is not vascularized and has little or no remodelling capacity, providing an excellent model to study biomineralization processes of skeletal tissues.

Natural blends combining chitosan (CS) and gelatin (Gel) have been applied as promising scaffold materials for mineralized tissue (primarily bone) regeneration [ ]. The use of CS as a bioactive compound is desirable due to its high biocompatibility, efficient biodegradability by enzymes into oligosaccharides that are rapidly resorbed, and the “Generally Recognized as Safe” (GRAS) status assigned by the US Food and Drug Administration [ ]. CS is capable of forming complexes with inorganic ceramics like hydroxyapatite (HA), as well as with organic compounds, like extracellular matrix (ECM) proteins, growth factors, or other biomaterials [ ]. In specific, blending CS with Gel is an important pathway to improve its biological and mechanical properties. Gelatin is a protein derived from collagen and contains the Arg–Gly–Asp (RGD) sequence found in the natural ECM, which is promoting initial integrin-mediated cell attachment, a crucial step to facilitate cell spreading and proliferation within the biomimetic matrix [ ]. Gelatin has been widely used in the biomedical field because of its merits, including biological origin, biodegradability, hydrogel properties, and commercial availability at comparatively low cost [ , ].

The incorporation of HA into biomimetic porous CS/Gel blends has also been found to enhance the mechanical properties, promote initial cell adhesion, and support the long-term cell growth [ ]. Maintaining higher cell proliferation and further inducing cell osteogenic differentiation were some of the assets of the incorporation of HA in the form of nanoparticles (nHA) inside CS/Gel scaffolds [ ]. HA is bioactive, osteoconductive, non-toxic, and non-immunogenic and its crystal structure is similar to that of bone mineral [ ]. Recently, HA nanoparticles (nHA) were used in CS/Gel scaffolds to increase biocompatibility and bioactivity for bone tissue engineering [ ]. Although several reports on the chemical and biological properties of CS/Gel/nHA blends demonstrate the increasing interest of these biopolymers in bone tissue regeneration, it is still not known whether they could be used as suitable scaffold materials to stimulate the differentiation of dental pulp stem cells (DPSCs) into odontoblastic lineages to induce mineralized dental tissue regeneration.

DPSCs represent a promising source of oral Mesenchymal Stem Cells (MSCs), with great importance in regenerative dentistry [ ]. These cells have been extensively studied for their in vitro multilineage differentiation potential towards osteo/odontogenic, adipogenic, chondrogenic, neurogenic, angiogenic, and myogenic lineages [ ], while in vivo studies confirm their ability to reconstitute functional dentin/pulp-like complexes [ ]. Previous research has shown that an exogenous application of Bone Morphogenic Protein-2 (BMP-2) or Dentin Matrix Protein (DMP-1) in DPSCs seeded in bioceramic scaffolds promoted the biomineralization and the formation of a nanocrystalline HA-rich dentin-like matrix [ ]. However, no reports so far have investigated the possibility of combining DPSCs with biomimetic hybrid CS/Gel/nHA blends towards mineralized dental tissue regeneration.

Based on the above, this study aims to evaluate the potential of hybrid CS/Gel/nHA scaffolds produced by freeze-drying to act as a porous microenvironment promoting attachment, viability, odontogenic differentiation and in vitro biomineralization of DPSCs.

Materials & methods

Synthesis of chitosan/gelatin/nano-hydroxyapatite (CS/Gel/nHA) scaffolds

The scaffolds were prepared by mixing a chitosan/gelatin blend with a nano-hydroxyapatite (nHA) suspension in ultrapure water according to modified protocols based on Ji et al. [ ] and Georgopoulou et al. [ ]. Chitosan, gelatin, nano-hydroxyapatite were purchased from Sigma-Aldrich. First, we dissolved 4% w/v low molecular weight (50−190 kDa) chitosan (CS) in solution of 1% v/v acetic acid and 4% w/v gelatin (Gel) in ultrapure demineralized water, stirred for 2 h at 50 °C and produced a 40%:60% CS:Gel blend. Then, we prepared a 10% w/v rod-like nano-hydroxyapatite suspension in ultrapure water, poured together with the CS/Gel blend at a concentration of 55% w/v, and stirred for 2 h at 50 °C. In this way we produced a composite material with a relative concentration of 55% w/v nHA to the CS/Gel blend. A volume of 400 μL of the above mixture was cast into each well of a 24-well plate, transferred to freeze at −20 °C overnight, and lyophilized for 24 h at −40 °C. Lyophilized scaffolds were crosslinked with 0.1% v/v glutaraldehyde, and lyophilized for another 24 h at −40 °C. Finally, scaffolds were neutralized by rinsing them with 0.1 N NaOH, then with ultrapure water until pH was neutral, and finally with PBS overnight prior their placing in a vented oven for 24 h at 37 °C.

Characterization of the CS/Gel scaffolds

Scanning electron microscopy (SEM)

For the morphological characterization of the scaffolds loaded with cells, Field-emission (FE) scanning electron microscopy (SEM) (FE-SEM, JEOL JSM-7000F) including energy-dispersive X-ray spectroscopy (EDS) analysis was performed. Briefly, the specimens were washed with PBS, fixed with 3% glutaraldehyde in 0.1M sodium cacodylate buffer (pH = 7.4), and dehydrated in an ascending series of ethanol/water (35, 50, 70, 95 and 100 % ethanol). Finally, specimens were dried in a critical point drier (Baltec CPD 030), sputter-coated with a 20 nm thick layer of gold-palladium (Baltec SCD 050) and observed under the SEM at an accelerating voltage of 15–20 kV. The average pore size of the scaffolds was determined by direct geometric analysis on the SEM images. Energy-dispersive X-ray spectroscopy (EDS) analysis (FE-SEM, JEOL JSM-7000F) was performed on a piece of CS/Gel/nHA scaffold which was placed on a carbon tape-coated stub. The sample was then platinum-coated for 1 min at 20 mA. The XRD patterns of the CS/Gel/nHA scaffolds were collected as described in the Subsection 2.7 .

Fourier transform infrared spectroscopic analysis (FTIR)

The Fourier transform infrared spectroscopy analysis (FTIR) of the CS/Gel/nHA scaffolds was recorded using an optical spectrometer (Nicolet 6700, Thermo Electron Corporation) in the region 400–4000 cm −1 . The spectral data were collected, and the numerical values were transferred to the software Origin for graphical representation.

Swelling analysis

The ability of lyophilized CS/Gel/nHA scaffolds to absorb water was determined by swelling them in phosphate buffer saline (PBS, pH 7.4). The dry samples were weighted and then placed in PBS for 30 min. The excess of water was removed with filter paper, and their weight was measured immediately. The percentage of water uptake was computed by the following formula:


W = W 1 -W 0 /W 0 ,

where W
o is the weight of dried scaffolds, while W
1 is the weight of wet scaffolds after 30 min in PBS. The values were expressed as the mean ± standard error (SE; n = 6).

Establishment of DPSC cultures

The enzymatic dissociation method was employed to generate DPSCs cultures from extracted third molars, as previously described [ ]. Each culture was established from one wisdom tooth per donor. This study was carried out in accordance with the recommendations of the Institutional Ethics Committee. The protocol was approved by the same Committee (number 46/20-3-2019). All subjects signed informed consent according to the Declaration of Helsinki. Disinfection with iodine was applied to the third molars, and a cut was made around the cementum-enamel junction to expose the pulp chamber. Then, the pulp tissue was retrieved, thoroughly minced, and digested in a solution of 3 mg/mL collagenase I and 4 mg/mL dispase II (Invitrogen, Karlsruhe, Germany) for 45 min at 37 °C. The cells were cultured in α-MEM (Minimum Essential Media) medium (Invitrogen), supplemented with 15% fetal bovine serum (FBS, Invitrogen), 100 mM L-ascorbic acid phosphate (Sigma-Aldrich, Steinheim, Germany) and antibiotics/antimycotics (=Complete Culture Medium; CCM) before been incubated at 37 °C in 5% CO 2 . All experiments were conducted with DPSCs, cultured in passage 2 to 6, collected from a minimum of three donors.

Immunophenotypic characterization of DPSC cultures

DPSCs were analyzed by flow cytometry for mesenchymal (STRO-1, CD146, CD90/Thy-1, CD73), endothelial (CD105/endoglin), embryonic (SSEA-4) and hematopoietic (CD34, CD45) stem cell (SC) markers, as previously described [ ]. Single-cell suspensions, obtained by culture trypsinization, were labeled for surface markers with the following fluorochrome-conjugated antibodies: STRO-1-FITC (fluorescein isothiocyanate), CD146-PE (phycoerythrin), CD90-FITC, CD73-PE, CD105-FITC, SSEA-4-FITC, CD34-APC (allophycocyanin), CD45-PE (all from BioLegend, Fell, Germany). After staining and washing of the cells with a FACS buffer (PBS + 1% BSA + 0.1% NaN 3 ), the labeled cells were analyzed using a Guava®easyCyte 8 H T Benchtop Flow Cytometer (Merck Millipore, Billerica, Massachusetts, U.S.A.). A total of 50,000 events/sample were acquired. Data were analyzed using the software Summit 5.1 (version 5.1 for Windows, Beckman Coulter, Inc., Krefeld, Germany).

Seeding of DPSCs into the CS/Gel/nHA scaffolds and analysis of cell morphology and viability

The synthesized CS/Gel/nHA scaffolds were placed in 24-well plates and exposed to UV-A light irradiation for 5 min for complete disinfection. Then, the scaffolds were incubated for 24 h with CCM at 37 °C and 5% CO 2 , aiming at their initial wetting with the serum-containing medium while achieving pH stabilization between 7.2 and 7.4. After reaching the desirable pH, each scaffold was spotted with 200 μL CCM containing 2 × 10 6 DPSCs and incubated for 1 h at 37 °C and 5% CO 2 to allow initial cell attachment. Afterwards, each spotted scaffold containing well was filled with 1 mL CCM. Medium change was performed every other day.

After 1, 3, 7, and 14 days cell viability was evaluated by live/dead staining fluorescent staining, applying calcein AM and ethidium homodimer (EthD-1) fluorescent dyes for living and dead cells respectively, and visualized by confocal microscopy. Meanwhile, the cell viability/proliferation was further assessed using a metabolic-based test (MTT assay) at the same time-points. SEM was employed to evaluate cell morphology within the CS/Gel/nHA scaffolds.

Evaluation of the morphological characteristics of cell-seeded scaffolds by SEM

For SEM observation, the DPSCs/scaffold constructs were washed with PBS and prepared as described in Section 2.2.1 .

Assessment of cell viability/proliferation based on metabolic activity

An MTT [3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay was used to assess cell viability/proliferation inside the CS/Gel/nHA scaffolds. Each well/scaffold was spotted with 5·10 5 cells as described in paragraph 2.5. After 1, 2, 3, 7 and 14 d, MTT (0.5 mg/mL in CCM) was added to each cell/scaffold construct and incubated for 4 h at 37 °C and 5% CO 2 . The MTT-insoluble formazan was then dissolved by DMSO that was applied for 4 h to the constructs at 37 °C. A wavelength of 545 nm and a reference filter of 630 nm were applied to measure the absorbance against blank (DMSO) by a microplate reader (Epock, Biotek, Biotek Instruments, Inc., Vermont, USA). Scaffolds without cells were treated and incubated under the same conditions to be used as control. Thereby, the optical density (OD) values of the control scaffolds were subtracted from values obtained by the corresponding cell-seeded CS/Gel/nHA scaffolds.

Evaluation of the ratio of living to dead cell by confocal microscopy

The cell-seeded CS/Gel/nHA scaffolds were double-stained calcein AM and EthD-1 fluorescent dyes. Stained cell/scaffold constructs were observed under a confocal microscope (Leica Microsystems, Wetzlar, Germany). Approximately 20 depth-dependent serial sections were obtained, and the projection (z-stacked) images were composed. The quantification of the percentage of living and dead cells was performed with the Image J color pixel counter plugin.

Evaluation of the odontogenic differentiation potential of DPSC-seeded CS/Gel/nHA scaffolds by real-time reverse-transcription polymerase chain reaction analysis (real-time PCR)

CS/Gel/nHA scaffolds were spotted with DPSCs as described in Section 2.5 . Total RNA isolation from each construct was performed after 1, 3, 7, and 14 d. Briefly, CCM was removed from each well containing the DPSC-seeded scaffolds, and after two washes with PBS, 600 μL collagenase I (4 mg/mL, Invitrogen) were added. The plates were incubated for 45 min in an incubator at 37 °C and 5% CO 2 . Then, the supernatant of each well was collected and placed into a falcon tube. Subsequently, 400 μL of a 0.25% trypsin/mM EDTA solution (Invitrogen) were added in each well containing the DPSC-seeded scaffolds and incubated for another 7 min at 37 °C and 5% CO 2 . Afterwards, the supernatant of each well was collected and pooled with the supernatant of the same sample collected after collagenase I treatment at the first step. The collected supernatants after both enzymatic treatments were centrifuged at 150 g for 5 min, followed by washing with PBS, and another centrifugation step under the same conditions. Finally, the supernatant was removed, and the remaining cell pellet was exposed to 700 μL RA1 Lysis Buffer, followed by RNA isolation by the Nucleospin RNA isolation kit (Macherey Nagel, Düren, Germany) according to the manufacturer’s instructions. All collected RNA samples were stored at −80 °C for the qPCR analysis.

Reverse transcription was conducted using a superscript first-strand synthesis kit (Takara, Takara Bio USA, Inc., Mountain View, CA), according to manufacturer’s instructions. Reactions were performed using SYBR-Select PCR Master Mix (Applied Biosystems, Foster City, CA) in a Step One Plus thermal cycler (Applied Biosystems). The reactions’ protocol started with two initial incubation steps at 50 °C for 2 min and at 95 °C for 2 min and were followed by 40 cycles of PCR, comprising denaturation for 15 s at 95 °C, and annealing/extension for 1 min at 60 °C. The Primer-Blast software from the NCBI nucleotide sequence database ( http://www.ncbi.nlm.nih.gov/BLAST ) was used to design primers for the following genes: DSPP, BMP-2, RUNX2, ALP, and Osterix ( Table 1 ). The results were adjusted by amplification efficiency (LinRegPCR) and normalized against two housekeeping genes (succinate dehydrogenase complex, subunit A, flavoprotein-SDH-A; beta-2-microglobulin-B2M).

Table 1
Real-time PCR primers designed for the analysis of several odontogenic differentiation-related genes and the respective amplicon sizes of the PCR products.
Gene symbol Forward (5’-3’) Reverse (5’-3’) Amplicon
size (bp)
DSPP GCTGGCCTGGATAATTCCGA CTCCTGGCCCTTGCTGTTAT 135
BMP-2 GGAACGGACATTCGGTCCTT AGTCCGTCTAAGAAGCACGC 100
ALP CCGTGGCAACTCTATCTTTGG CAGGCCCATTGCCATACAG 89
RUNX2 CCACCGAGACCAACAGAGTC TCACTGTGCTGAAGAGGCTG 118
OSTERIX (SP7) ATCCAGCCCCCTTTACAAGC TAGCATAGCCTGAGGTGGGT 78
B2M TGTCTTTCAGCAAGGACTGGT ACATGTCTCGATCCCACTTAAC 138
SDHA GCATGCCAGGGAAGACTACA GCCAACGTCCACATAGGACA 127

Mineralized tissue characterization inside the CS/Gel/nHA scaffolds

CS/Gel/nHA scaffolds were spotted with DPSCs as described in Section 2.5 and cultured with CCM, supplemented with 1.8 mM KH 2 PO 4 (monopotassium phosphate) and 5 mM beta-glycerophosphate, to provide the phosphate sources necessary for the in vitro biomineralization. Medium change was performed every other day for a total of 48 d. Cell-free scaffolds were used as controls for this assay to assess chemical calcium phosphate (CaP) precipitation due to the addition of phosphates to the culture medium. After 14, 28, and 48 d, samples were processed for SEM examination combined with energy-dispersive X-ray spectroscopy (SEM-EDS), as described in Section 2.1 , to visualize the porous structure of DPSC-seeded scaffolds and to provide the elemental composition of the formed calcium phosphate phases, respectively. For the microscopic (SEM) and spectroscopic (EDS) analyses of the samples of the in vitro biomineralization experiments, an ESEM Quanta 400 FEG instrument (FEI), equipped with EDS spectroscopy (EDS; Genesis 4000, SUTW-Si (Li) detector) operating in a high vacuum with gold/palladium-sputtered samples were used. In addition, XRD measurements were carried out to crystallographically investigate the inorganic part of the DPSC-seeded scaffolds (biomineralization process). The porous samples, ground into a fine powder, were deposited on a silicon single crystal sample holder to minimize scattering and investigated in Bragg-Brentano geometry with a Bruker D8 Advance instrument (Cu K α radiation, 1.54 Å, 40 kV and 40 mA). All samples were rotated and measured from 5−90° 2 θ with a step size of 0.01° and a counting time of 0.6 s at each step. The phase analysis was performed with the software Diffrac Suite EVA V1.2 from Bruker using the patterns of hydroxyapatite HAP (#09-0432) from the ICDD database as references. After the instrumental characterization of the diffractometer by measuring a standard powder sample LaB 6 from NIST (SRM 660b; a (LaB 6 ) =4.15689 Å), Rietveld refinement with the program package TOPAS 4.2 from Bruker enabled the determination of the lattice parameters a and c (hexagonal crystal system of HAP) and crystallite size D of the formed calcium phosphate particles.

Statistics

All assays were performed in three independent biological experiments (n = 3) with two to four technical replicates each. The experimental data were analyzed using one-way ANOVA, followed by Tukey’s post-hoc test for multiple comparisons between groups. Normal distribution was confirmed by D'Agostino & Pearson normality tests. Data were expressed as means ± standard deviation (SD) or ± standard error (SE). For the above-mentioned analyses the GraphPad Prism 6.0 (GraphPad Software, Inc.; La Jolla, CA 92037 USA) was used (* p < 0.05; ** p < 0.01; n.s. denotes statistically non-significant).

You're Reading a Preview

Become a DentistryKey membership for Full access and enjoy Unlimited articles

Become membership

If you are a member. Log in here

Was this article helpful?

Hybrid chitosan/gelatin/nanohydroxyapatite scaffolds promote odontogenic differentiation of dental pulp stem cells and in vitro biomineralization Georgia Vagropoulou , Maria Trentsiou , Anthie Georgopoulou , Eleni Papachristou , Oleg Prymak , Aristeidis Kritis , Matthias Epple , Maria Chatzinikolaidou , Athina Bakopoulou and Petros Koidis Dental Materials, 2021-01-01, Volume 37, Issue 1, Pages e23-e36, Copyright © 2020 The Academy of Dental Materials Abstract Objective Hybrid chitosan/gelatin/nanohydroxyapatite (CS/Gel/nHA) scaffolds have attracted considerable interest in tissue engineering (TE) of mineralized tissues. The present study aimed to investigate the potential of CS/Gel/nHA scaffolds loaded with dental pulp stem cells (DPSCs) to induce odontogenic differentiation and in vitro biomineralization. Methods CS/Gel/nHA scaffolds were synthesized by freeze-drying, seeded with DPSCs, and characterized with flow cytometry. Scanning Electron Microscopy (SEM), live/dead staining, and MTT assays were used to evaluate cell morphology and viability; real-time PCR for odontogenesis-related gene expression analysis; SEM-EDS (Energy Dispersive X-ray spectroscopy), and X-ray Diffraction analysis (XRD) for structural and chemical characterization of the mineralized constructs, respectively. Results CS/Gel/nHA scaffolds supported viability and proliferation of DPSCs over 14 days in culture. Gene expression patterns indicated pronounced odontogenic shift of DPSCs, evidenced by upregulation of DSPP, BMP-2, ALP, and the transcription factors RunX2 and Osterix . SEM-EDS showed the production of a nanocrystalline mineralized matrix inside the cell-based and - to a lesser extent - the cell-free constructs, with a time-dependent production of net-like nanocrystals (appr. 25−30 nm in diameter). XRD analysis gave the crystallite size ( D = 50 nm) but could not distinguish between the initially incorporated and the biologically produced nHA. Significance This is the first study validating the potential of CS/Gel/nHA scaffolds to support viability and proliferation of DPSCs, and to provide a biomimetic microenvironment favoring odontogenic differentiation and in vitro biomineralization without the addition of any inductive factors, including dexamethasone and/or growth/morphogenetic factors. These results reveal a promising strategy towards TE of mineralized dental tissues. 1 Introduction Numerous studies have provided evidence that restorative dental procedures are closely linked to several biological and technical complications, as well as adverse reactions, leading to unpredictable therapeutic efficiency [ ]. The latter justifies the rationale for pursuing regeneration approaches for dentin – the bulk of a tooth's structure – as the ultimate goal of modern dental tissue engineering (TE) strategies. In recent years, TE has achieved regeneration of the dentin/pulp complex in preclinical [ , ] and clinical models [ ] or even regeneration of bio-roots [ , ] and fully functional teeth in animal models [ , ]. TE aims to regenerate tissues and organs by using cell and biomaterial-based approaches. Towards this direction, the selection of suitable scaffold materials, providing the three-dimensional microenvironment mimicking the extracellular matrix (ECM), is of crucial importance. Different scaffold materials have been employed for mineralized tissue regeneration applications, including porous bioceramics ( e.g. hydroxyapatite/HA, and β-tricalcium phosphate/β-TCP), natural molecules ( e.g. collagen and chitosan), as well as synthetic polymers ( e.g. polyglycolic acid/ PGA and polylactic acid/ PLA) [ , ]. Each material offers variable chemical and structural characteristics, degradation properties, and versatility in handling; nevertheless, only a few have been used effectively for the targeted regeneration of mineralized dental tissues [ ]. Dentin is a complex structure comprising various tissues with different functions and specificities regarding extracellular matrix (ECM) content, and crystallographic profiles. It includes tubular dentin (orthodentin) that represents the main structure produced during dentinogenesis by meta-mitotic odontoblasts, with cell bodies located outside the predentin/dentin layer at the pulp periphery and cell processes extending inside the dentin tubules. After tooth eruption, response to mild trauma ( e.g. carious decay or abrasion), leads to the production of the reactionary (tertiary) dentin by the odontoblastic or subjacent pre-odontoblastic (Hoel’s) cells, that may appear either as tubular or atubular orthodentin or as less organized bone-like tissue (osteodentin). In case of severe trauma (deep caries, restorative procedures etc. ) leading to disruption of the odontoblastic layer, a less mineralized, bone-like tissue called reparative dentin (osteodentin), is produced as a result of the activity of pulp stem/progenitor cells [ ]. Dentin primarily consists of a mineral phase (70 wt %), an organic phase (20 wt %), and water (10 wt %). The organic phase primarily comprises collagen I (90% in intertubular dentin), and other non-collagenous proteins (NCP), including the Small Integrin-Binding Ligand N-linked Glycoproteins (SIBLINGs), such as DSPP, DMP-1, BSP, OPN and MEPE [ ], the Small Leucine-rich proteoglycans (SLRPS), such as biglycan, and decorin and fibromodulin, non-phosphorylated proteins, such as osteocalcin, growth factors, enzymes, phospholipids, proteolipids etc. Despite some similarities in structure, dentin – in contrast to bone – is not vascularized and has little or no remodelling capacity, providing an excellent model to study biomineralization processes of skeletal tissues. Natural blends combining chitosan (CS) and gelatin (Gel) have been applied as promising scaffold materials for mineralized tissue (primarily bone) regeneration [ ]. The use of CS as a bioactive compound is desirable due to its high biocompatibility, efficient biodegradability by enzymes into oligosaccharides that are rapidly resorbed, and the “Generally Recognized as Safe” (GRAS) status assigned by the US Food and Drug Administration [ ]. CS is capable of forming complexes with inorganic ceramics like hydroxyapatite (HA), as well as with organic compounds, like extracellular matrix (ECM) proteins, growth factors, or other biomaterials [ ]. In specific, blending CS with Gel is an important pathway to improve its biological and mechanical properties. Gelatin is a protein derived from collagen and contains the Arg–Gly–Asp (RGD) sequence found in the natural ECM, which is promoting initial integrin-mediated cell attachment, a crucial step to facilitate cell spreading and proliferation within the biomimetic matrix [ ]. Gelatin has been widely used in the biomedical field because of its merits, including biological origin, biodegradability, hydrogel properties, and commercial availability at comparatively low cost [ , ]. The incorporation of HA into biomimetic porous CS/Gel blends has also been found to enhance the mechanical properties, promote initial cell adhesion, and support the long-term cell growth [ ]. Maintaining higher cell proliferation and further inducing cell osteogenic differentiation were some of the assets of the incorporation of HA in the form of nanoparticles (nHA) inside CS/Gel scaffolds [ ]. HA is bioactive, osteoconductive, non-toxic, and non-immunogenic and its crystal structure is similar to that of bone mineral [ ]. Recently, HA nanoparticles (nHA) were used in CS/Gel scaffolds to increase biocompatibility and bioactivity for bone tissue engineering [ ]. Although several reports on the chemical and biological properties of CS/Gel/nHA blends demonstrate the increasing interest of these biopolymers in bone tissue regeneration, it is still not known whether they could be used as suitable scaffold materials to stimulate the differentiation of dental pulp stem cells (DPSCs) into odontoblastic lineages to induce mineralized dental tissue regeneration. DPSCs represent a promising source of oral Mesenchymal Stem Cells (MSCs), with great importance in regenerative dentistry [ ]. These cells have been extensively studied for their in vitro multilineage differentiation potential towards osteo/odontogenic, adipogenic, chondrogenic, neurogenic, angiogenic, and myogenic lineages [ ], while in vivo studies confirm their ability to reconstitute functional dentin/pulp-like complexes [ ]. Previous research has shown that an exogenous application of Bone Morphogenic Protein-2 (BMP-2) or Dentin Matrix Protein (DMP-1) in DPSCs seeded in bioceramic scaffolds promoted the biomineralization and the formation of a nanocrystalline HA-rich dentin-like matrix [ ]. However, no reports so far have investigated the possibility of combining DPSCs with biomimetic hybrid CS/Gel/nHA blends towards mineralized dental tissue regeneration. Based on the above, this study aims to evaluate the potential of hybrid CS/Gel/nHA scaffolds produced by freeze-drying to act as a porous microenvironment promoting attachment, viability, odontogenic differentiation and in vitro biomineralization of DPSCs. 2 Materials & methods 2.1 Synthesis of chitosan/gelatin/nano-hydroxyapatite (CS/Gel/nHA) scaffolds The scaffolds were prepared by mixing a chitosan/gelatin blend with a nano-hydroxyapatite (nHA) suspension in ultrapure water according to modified protocols based on Ji et al. [ ] and Georgopoulou et al. [ ]. Chitosan, gelatin, nano-hydroxyapatite were purchased from Sigma-Aldrich. First, we dissolved 4% w/v low molecular weight (50−190 kDa) chitosan (CS) in solution of 1% v/v acetic acid and 4% w/v gelatin (Gel) in ultrapure demineralized water, stirred for 2 h at 50 °C and produced a 40%:60% CS:Gel blend. Then, we prepared a 10% w/v rod-like nano-hydroxyapatite suspension in ultrapure water, poured together with the CS/Gel blend at a concentration of 55% w/v, and stirred for 2 h at 50 °C. In this way we produced a composite material with a relative concentration of 55% w/v nHA to the CS/Gel blend. A volume of 400 μL of the above mixture was cast into each well of a 24-well plate, transferred to freeze at −20 °C overnight, and lyophilized for 24 h at −40 °C. Lyophilized scaffolds were crosslinked with 0.1% v/v glutaraldehyde, and lyophilized for another 24 h at −40 °C. Finally, scaffolds were neutralized by rinsing them with 0.1 N NaOH, then with ultrapure water until pH was neutral, and finally with PBS overnight prior their placing in a vented oven for 24 h at 37 °C. 2.2 Characterization of the CS/Gel scaffolds 2.2.1 Scanning electron microscopy (SEM) For the morphological characterization of the scaffolds loaded with cells, Field-emission (FE) scanning electron microscopy (SEM) (FE-SEM, JEOL JSM-7000F) including energy-dispersive X-ray spectroscopy (EDS) analysis was performed. Briefly, the specimens were washed with PBS, fixed with 3% glutaraldehyde in 0.1M sodium cacodylate buffer (pH = 7.4), and dehydrated in an ascending series of ethanol/water (35, 50, 70, 95 and 100 % ethanol). Finally, specimens were dried in a critical point drier (Baltec CPD 030), sputter-coated with a 20 nm thick layer of gold-palladium (Baltec SCD 050) and observed under the SEM at an accelerating voltage of 15–20 kV. The average pore size of the scaffolds was determined by direct geometric analysis on the SEM images. Energy-dispersive X-ray spectroscopy (EDS) analysis (FE-SEM, JEOL JSM-7000F) was performed on a piece of CS/Gel/nHA scaffold which was placed on a carbon tape-coated stub. The sample was then platinum-coated for 1 min at 20 mA. The XRD patterns of the CS/Gel/nHA scaffolds were collected as described in the Subsection 2.7 . 2.2.2 Fourier transform infrared spectroscopic analysis (FTIR) The Fourier transform infrared spectroscopy analysis (FTIR) of the CS/Gel/nHA scaffolds was recorded using an optical spectrometer (Nicolet 6700, Thermo Electron Corporation) in the region 400–4000 cm −1 . The spectral data were collected, and the numerical values were transferred to the software Origin for graphical representation. 2.2.3 Swelling analysis The ability of lyophilized CS/Gel/nHA scaffolds to absorb water was determined by swelling them in phosphate buffer saline (PBS, pH 7.4). The dry samples were weighted and then placed in PBS for 30 min. The excess of water was removed with filter paper, and their weight was measured immediately. The percentage of water uptake was computed by the following formula: W = W 1 -W 0 /W 0 , where W o is the weight of dried scaffolds, while W 1 is the weight of wet scaffolds after 30 min in PBS. The values were expressed as the mean ± standard error (SE; n = 6). 2.3 Establishment of DPSC cultures The enzymatic dissociation method was employed to generate DPSCs cultures from extracted third molars, as previously described [ ]. Each culture was established from one wisdom tooth per donor. This study was carried out in accordance with the recommendations of the Institutional Ethics Committee. The protocol was approved by the same Committee (number 46/20-3-2019). All subjects signed informed consent according to the Declaration of Helsinki. Disinfection with iodine was applied to the third molars, and a cut was made around the cementum-enamel junction to expose the pulp chamber. Then, the pulp tissue was retrieved, thoroughly minced, and digested in a solution of 3 mg/mL collagenase I and 4 mg/mL dispase II (Invitrogen, Karlsruhe, Germany) for 45 min at 37 °C. The cells were cultured in α-MEM (Minimum Essential Media) medium (Invitrogen), supplemented with 15% fetal bovine serum (FBS, Invitrogen), 100 mM L-ascorbic acid phosphate (Sigma-Aldrich, Steinheim, Germany) and antibiotics/antimycotics (=Complete Culture Medium; CCM) before been incubated at 37 °C in 5% CO 2 . All experiments were conducted with DPSCs, cultured in passage 2 to 6, collected from a minimum of three donors. 2.4 Immunophenotypic characterization of DPSC cultures DPSCs were analyzed by flow cytometry for mesenchymal (STRO-1, CD146, CD90/Thy-1, CD73), endothelial (CD105/endoglin), embryonic (SSEA-4) and hematopoietic (CD34, CD45) stem cell (SC) markers, as previously described [ ]. Single-cell suspensions, obtained by culture trypsinization, were labeled for surface markers with the following fluorochrome-conjugated antibodies: STRO-1-FITC (fluorescein isothiocyanate), CD146-PE (phycoerythrin), CD90-FITC, CD73-PE, CD105-FITC, SSEA-4-FITC, CD34-APC (allophycocyanin), CD45-PE (all from BioLegend, Fell, Germany). After staining and washing of the cells with a FACS buffer (PBS + 1% BSA + 0.1% NaN 3 ), the labeled cells were analyzed using a Guava®easyCyte 8 H T Benchtop Flow Cytometer (Merck Millipore, Billerica, Massachusetts, U.S.A.). A total of 50,000 events/sample were acquired. Data were analyzed using the software Summit 5.1 (version 5.1 for Windows, Beckman Coulter, Inc., Krefeld, Germany). 2.5 Seeding of DPSCs into the CS/Gel/nHA scaffolds and analysis of cell morphology and viability The synthesized CS/Gel/nHA scaffolds were placed in 24-well plates and exposed to UV-A light irradiation for 5 min for complete disinfection. Then, the scaffolds were incubated for 24 h with CCM at 37 °C and 5% CO 2 , aiming at their initial wetting with the serum-containing medium while achieving pH stabilization between 7.2 and 7.4. After reaching the desirable pH, each scaffold was spotted with 200 μL CCM containing 2 × 10 6 DPSCs and incubated for 1 h at 37 °C and 5% CO 2 to allow initial cell attachment. Afterwards, each spotted scaffold containing well was filled with 1 mL CCM. Medium change was performed every other day. After 1, 3, 7, and 14 days cell viability was evaluated by live/dead staining fluorescent staining, applying calcein AM and ethidium homodimer (EthD-1) fluorescent dyes for living and dead cells respectively, and visualized by confocal microscopy. Meanwhile, the cell viability/proliferation was further assessed using a metabolic-based test (MTT assay) at the same time-points. SEM was employed to evaluate cell morphology within the CS/Gel/nHA scaffolds. 2.5.1 Evaluation of the morphological characteristics of cell-seeded scaffolds by SEM For SEM observation, the DPSCs/scaffold constructs were washed with PBS and prepared as described in Section 2.2.1 . 2.5.2 Assessment of cell viability/proliferation based on metabolic activity An MTT [3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay was used to assess cell viability/proliferation inside the CS/Gel/nHA scaffolds. Each well/scaffold was spotted with 5·10 5 cells as described in paragraph 2.5. After 1, 2, 3, 7 and 14 d, MTT (0.5 mg/mL in CCM) was added to each cell/scaffold construct and incubated for 4 h at 37 °C and 5% CO 2 . The MTT-insoluble formazan was then dissolved by DMSO that was applied for 4 h to the constructs at 37 °C. A wavelength of 545 nm and a reference filter of 630 nm were applied to measure the absorbance against blank (DMSO) by a microplate reader (Epock, Biotek, Biotek Instruments, Inc., Vermont, USA). Scaffolds without cells were treated and incubated under the same conditions to be used as control. Thereby, the optical density (OD) values of the control scaffolds were subtracted from values obtained by the corresponding cell-seeded CS/Gel/nHA scaffolds. 2.5.3 Evaluation of the ratio of living to dead cell by confocal microscopy The cell-seeded CS/Gel/nHA scaffolds were double-stained calcein AM and EthD-1 fluorescent dyes. Stained cell/scaffold constructs were observed under a confocal microscope (Leica Microsystems, Wetzlar, Germany). Approximately 20 depth-dependent serial sections were obtained, and the projection (z-stacked) images were composed. The quantification of the percentage of living and dead cells was performed with the Image J color pixel counter plugin. 2.6 Evaluation of the odontogenic differentiation potential of DPSC-seeded CS/Gel/nHA scaffolds by real-time reverse-transcription polymerase chain reaction analysis (real-time PCR) CS/Gel/nHA scaffolds were spotted with DPSCs as described in Section 2.5 . Total RNA isolation from each construct was performed after 1, 3, 7, and 14 d. Briefly, CCM was removed from each well containing the DPSC-seeded scaffolds, and after two washes with PBS, 600 μL collagenase I (4 mg/mL, Invitrogen) were added. The plates were incubated for 45 min in an incubator at 37 °C and 5% CO 2 . Then, the supernatant of each well was collected and placed into a falcon tube. Subsequently, 400 μL of a 0.25% trypsin/mM EDTA solution (Invitrogen) were added in each well containing the DPSC-seeded scaffolds and incubated for another 7 min at 37 °C and 5% CO 2 . Afterwards, the supernatant of each well was collected and pooled with the supernatant of the same sample collected after collagenase I treatment at the first step. The collected supernatants after both enzymatic treatments were centrifuged at 150 g for 5 min, followed by washing with PBS, and another centrifugation step under the same conditions. Finally, the supernatant was removed, and the remaining cell pellet was exposed to 700 μL RA1 Lysis Buffer, followed by RNA isolation by the Nucleospin RNA isolation kit (Macherey Nagel, Düren, Germany) according to the manufacturer’s instructions. All collected RNA samples were stored at −80 °C for the qPCR analysis. Reverse transcription was conducted using a superscript first-strand synthesis kit (Takara, Takara Bio USA, Inc., Mountain View, CA), according to manufacturer’s instructions. Reactions were performed using SYBR-Select PCR Master Mix (Applied Biosystems, Foster City, CA) in a Step One Plus thermal cycler (Applied Biosystems). The reactions’ protocol started with two initial incubation steps at 50 °C for 2 min and at 95 °C for 2 min and were followed by 40 cycles of PCR, comprising denaturation for 15 s at 95 °C, and annealing/extension for 1 min at 60 °C. The Primer-Blast software from the NCBI nucleotide sequence database ( http://www.ncbi.nlm.nih.gov/BLAST ) was used to design primers for the following genes: DSPP, BMP-2, RUNX2, ALP, and Osterix ( Table 1 ). The results were adjusted by amplification efficiency (LinRegPCR) and normalized against two housekeeping genes (succinate dehydrogenase complex, subunit A, flavoprotein-SDH-A; beta-2-microglobulin-B2M). Table 1 Real-time PCR primers designed for the analysis of several odontogenic differentiation-related genes and the respective amplicon sizes of the PCR products. Gene symbol Forward (5’-3’) Reverse (5’-3’) Amplicon size (bp) DSPP GCTGGCCTGGATAATTCCGA CTCCTGGCCCTTGCTGTTAT 135 BMP-2 GGAACGGACATTCGGTCCTT AGTCCGTCTAAGAAGCACGC 100 ALP CCGTGGCAACTCTATCTTTGG CAGGCCCATTGCCATACAG 89 RUNX2 CCACCGAGACCAACAGAGTC TCACTGTGCTGAAGAGGCTG 118 OSTERIX (SP7) ATCCAGCCCCCTTTACAAGC TAGCATAGCCTGAGGTGGGT 78 B2M TGTCTTTCAGCAAGGACTGGT ACATGTCTCGATCCCACTTAAC 138 SDHA GCATGCCAGGGAAGACTACA GCCAACGTCCACATAGGACA 127 2.7 Mineralized tissue characterization inside the CS/Gel/nHA scaffolds CS/Gel/nHA scaffolds were spotted with DPSCs as described in Section 2.5 and cultured with CCM, supplemented with 1.8 mM KH 2 PO 4 (monopotassium phosphate) and 5 mM beta-glycerophosphate, to provide the phosphate sources necessary for the in vitro biomineralization. Medium change was performed every other day for a total of 48 d. Cell-free scaffolds were used as controls for this assay to assess chemical calcium phosphate (CaP) precipitation due to the addition of phosphates to the culture medium. After 14, 28, and 48 d, samples were processed for SEM examination combined with energy-dispersive X-ray spectroscopy (SEM-EDS), as described in Section 2.1 , to visualize the porous structure of DPSC-seeded scaffolds and to provide the elemental composition of the formed calcium phosphate phases, respectively. For the microscopic (SEM) and spectroscopic (EDS) analyses of the samples of the in vitro biomineralization experiments, an ESEM Quanta 400 FEG instrument (FEI), equipped with EDS spectroscopy (EDS; Genesis 4000, SUTW-Si (Li) detector) operating in a high vacuum with gold/palladium-sputtered samples were used. In addition, XRD measurements were carried out to crystallographically investigate the inorganic part of the DPSC-seeded scaffolds (biomineralization process). The porous samples, ground into a fine powder, were deposited on a silicon single crystal sample holder to minimize scattering and investigated in Bragg-Brentano geometry with a Bruker D8 Advance instrument (Cu K α radiation, 1.54 Å, 40 kV and 40 mA). All samples were rotated and measured from 5−90° 2 θ with a step size of 0.01° and a counting time of 0.6 s at each step. The phase analysis was performed with the software Diffrac Suite EVA V1.2 from Bruker using the patterns of hydroxyapatite HAP (#09-0432) from the ICDD database as references. After the instrumental characterization of the diffractometer by measuring a standard powder sample LaB 6 from NIST (SRM 660b; a (LaB 6 ) =4.15689 Å), Rietveld refinement with the program package TOPAS 4.2 from Bruker enabled the determination of the lattice parameters a and c (hexagonal crystal system of HAP) and crystallite size D of the formed calcium phosphate particles. 2.8 Statistics All assays were performed in three independent biological experiments (n = 3) with two to four technical replicates each. The experimental data were analyzed using one-way ANOVA, followed by Tukey’s post-hoc test for multiple comparisons between groups. Normal distribution was confirmed by D'Agostino & Pearson normality tests. Data were expressed as means ± standard deviation (SD) or ± standard error (SE). For the above-mentioned analyses the GraphPad Prism 6.0 (GraphPad Software, Inc.; La Jolla, CA 92037 USA) was used (* p < 0.05; ** p < 0.01; n.s. denotes statistically non-significant). 3 Results 3.1 Characterization of the CS/Gel/nHA scaffolds The physicochemical characterization of the composite CS/Gel/nHA scaffolds with a relative concentration of 55% w/v nHA to the CS/Gel blend, and a relative ratio of 18%:27%:55% CS:Gel:nHA is summarized in Fig. 1 . The scaffolds soften after immersion in an aqueous solution ( Fig. 1 a), indicating similar mechanical properties as the CS/Gel scaffolds reported by Georgopoulou et al. [ ]. Representative SEM images showed that the pores of scaffolds appeared to be relatively spherical and flattened, with a pore size ranging between 70 to 120 μm ( Fig. 1 b). The nHA particles were well-distributed within the CS/Gel matrix ( Figs. 1 c, d). The EDS analysis of CS/Gel/nHA scaffolds confirmed the presence of calcium and phosphate of nHA ( Fig. 1 e). The XRD analysis confirmed the presence of HA in scaffolds with the characteristic peak around 32° (2 θ ) ( Fig. 1 f). The FTIR spectrum of nHA showed a peak at 3571 cm −1 , which corresponds to OH stretching. The band at 1045 cm −1 corresponds to c3 of phosphate mode while the band at 571 cm −1 corresponds to c4 of phosphate. Overall, the FTIR analysis shows that the characteristic bands of nHA, CS, and Gel are present in the hybrid scaffolds ( Fig. 1 g). Finally, the water absorption was significantly lower in CS/Gel/nHA scaffolds compared to CS/Gel scaffolds without nHA ( Fig. 1 h). Fig. 1 Characterization of fabricated CS/Gel/nHA scaffolds (a) Macroscopic image of the prepared by the freeze-drying technique scaffolds (b) SEM image (x200) illustrating the morphology of CS/Gel/nHA scaffolds crosslinked with 0.1 % v/v glutaraldehyde (GTA). The pores of scaffolds appeared to be spherical and interconnected with a mean pore size between 70-120 μm. (c) SEM image (x500) showing a pore of approx. 100 μm in diameter. (d) SEM image (x2000) showing nHA particles distributed within the chitosan/gelatin matrix (e) The EDS spectrum confirmed the presence of calcium and phosphate of nHA. (f) XRD diffractogram confirming the presence of a hydroxyapatite (HA) phase by the characteristic peak around 32° (2 θ ). (g) FTIR spectra show the characteristic bands of nHA, chitosan, and gelatin in the hybrid scaffolds. (h) Percentage of water absorption of the prepared CS/Gel/nHA scaffolds. Error bars represent the average of triplicates (± SE) of three independent experiments (n = 3). 3.2 Immunophenotypic characterization of the DPSC cultures The DPSC cultures used in this study showed a high expression of mesenchymal stem cell markers, including CD90/Thy-1 (99.3 ± 0.4%), CD146 (71.6 ± 2.6%), CD73 (98.9 ± 0.9%), STRO-1 (18.1 ± 2.0%), CD105 (87.7 ± 3.2%) and the embryonic stem cell marker SSEA-4 (47.4 ± 3.1%). As expected, the hematopoietic stem cell markers CD34 and CD45 showed a minor expression (<1%). The results of the immunophenotypic characterization of the DPSCs are depicted in Fig. 2 . Fig. 2 Immunophenotypic characterization of DPSCs by flow cytometry for the expression of for mesenchymal (STRO-1, CD146, CD90/Thy-1, CD73), endothelial (CD105/endoglin), embryonic (SSEA-4) and hematopoietic (CD34, CD45) stem cell (SC) markers (green line: unstained control, red line: marker of interest). Results are means (± SD) of three independent experiments (n = 3). 3.3 Evaluation of morphology and viability/proliferation of DPSCs inside the CS/Gel/nHA scaffolds SEM observation showed that an effective adhesion of DPCSs inside the porous structure of CS/Gel/nHA scaffolds occurred as early as day (D) 1 post-seeding. The cells exhibited a typical elongated shape with cytoplasmic extensions and multiple filopodia. The cell morphology was maintained until D14 of culture while a time-dependent increase in cell density was observed due to cell proliferation inside the scaffolds ( Fig. 3 a-d). Fig. 3 Evaluation of cell attachment and viability/proliferation of DPSCs inside the CS/Gel/nHA scaffolds (a-d). SEM images show a successful adhesion and spreading of DPCSs inside the CS/Gel/nHA scaffolds after 1, 3, 7, and 14 days in culture. (e) MTT cell viability/proliferation assay of DPSC and CS/Gel/nHA scaffolds after 1, 3, 7 and 14 days in culture. Results are means (±SD) of three independent experiments (n = 3) in triplicates. One-way ANOVA, followed by Tukey’s post-hoc test for multiple comparisons between groups was used. Asterisks indicate statistical significance (* p < 0.05; ** p < 0.01, n.s. denotes non-significant). (f-i). Live/dead fluorescent staining with calcein-AM/ethidium homodimer and confocal microscopy representative images of DPCSs inside the CS/Gel/nHA scaffolds after 1, 3, 7, and 14 days in culture. High levels of cell viability (mean ± SD of three independent experiments, n = 3) with very few dead cells (<5–10 %) could be observed at all time-points. White arrows indicate sparse areas where cells are organized in clusters (scale bars: 100 μm). The MTT assay demonstrated a stable mitochondrial dehydrogenase activity until D3, and a significant (p < 0.01) time-dependent decrease on D7 and D14, attributed to the initiation of cell differentiation, leading to down-grading of cell proliferation rate ( Fig. 3 e). Live/dead fluorescent staining confirmed that the majority of the cells (>95%) remained viable throughout the observation period (up to D14), as they appeared green by the calcein-AM staining, in contrast to the few dead cells stained red with the EthD-1 fluorescent dye. Noticeably, cells were evenly distributed inside the entire porous structure of the scaffold, well attached to the struts and fully covering its pores, which is characteristic of an efficient spreading of the initially seeded cell population. In most areas, cells exhibited wide cytoplasm spreading throughout the scaffold. A few random but sparse areas of cells organized in clusters could be also observed (indicated with white arrows) ( Fig. 3 f–i). 3.4 Analysis of expression of odontogenic differentiation genes by DPSCs inside the CS/Gel/nHA scaffolds The expression level of several odontogenesis-related genes was evaluated, and compared to the baseline expression of D1 post-seeding. The results of gene expression patterns are depicted in Fig. 4 . Fig. 4 Real-time PCR analysis of the expression of odontogenic genes, including (a) DSPP , (b) ALP , (c) BMP-2 , (d) Osterix and (e) RunX2 in DPSC-seeded CS/Gel/nHA scaffolds after 1, 3, 7, and 14 days in culture. The values are means (±SD) of three independent experiments (n = 3) in duplicates. Asterisks demonstrate differences that are statistically significant differences in gene expression at each time-point compared to the baseline expression at day 1. SDHA and B2M were used as housekeeping controls (* p < 0.05; ** p < 0.01, n.s. designates non-significant). One-way ANOVA, followed by Tukey’s post-hoc test for multiple comparisons between groups was performed. Overall, a time-dependent upregulation of all odontogenesis-related markers was observed. In specific, statistically significant upregulation was recorded for DSPP (D3, D14), ALP (D7, D14), BMP-2 (D3, D14), and the odontogenesis-related transcription factors Osterix (D3, D14), RunX2 (D3, D14). The gene expression of DSPP and BMP-2 showed similar regulation patterns, with an initial expression peak on D3 (4.5 ± 1.0 - fold for DSPP and 6.6 ± 0.7- fold for BMP-2 respectively, p < 0.05), followed by a downregulation on D7, and another higher peak on D14 (14.9 ± 1.3 - fold for DSPP and 15.3 ± 1.9 - fold for BMP-2 respectively, p < 0.01). The gene expression of ALP showed a sharp increase on D7, reaching a 296.6 ± 24.2 - fold upregulation compared to the baseline expression ( p < 0.01), followed by significant downregulation on D14 ( p < 0.01). The transcription factor Osterix , showed a significant increase on D3 (7.6 ± 1.9 - fold, p < 0.01), followed by downregulation on D7, and another, but lower peak on D14 (4.9 ± 0.6 - fold, p < 0.05). Lastly, the transcription factor RunX2 showed the highest increase in expression on D7 ( p < 0.01), following similar expression pattern to ALP. 3.5 Characterization of the mineralized tissue produced inside the CS/Gel/nHA scaffolds SEM-EDS analysis after 14, 28, and 48 days in culture showed effective mineralization, as assessed by the production of a CaP phase-rich nanocrystalline structure, that overspread the entire scaffold in both cell-free ( Figs. 5 a–c), and to a higher degree in cell-seeded ( Figs. 5 d–f) constructs. The first was attributed to chemical precipitation, while the latter may also be due to additional mineralized matrix production by cell-mediated biomineralization. DPSC bodies were covered and embedded within the newly produced mineralized matrix. Net-like connected CaP nanocrystals (appr. 25−30 nm in diameter) were found in many pores of the scaffolds, and the density of the newly formed CaP phase seemed to increase over time, from D14 to D48. An EDS-based determination of the calcium (Ca) to phosphorus (P) ratio showed that it was on average 1.62 for the cell-free ( Fig. 5 g) and 1.75 for the cell-seeded scaffolds ( Fig. 5 h). However, this includes also the background of the nHA that was present in the scaffolds after preparation. Fig. 5 SEM images (x 1000) of the cell-free (a-c) and cell-seeded (d-f) CS/Gel/nHA scaffolds after 14, 28, and 48 days in culture. A CaP phase-rich nanocrystalline structure was visible in both cell-free and - to a higher degree - in cell-seeded constructs. Net-like connected CaP nanocrystals (appr. 25–30 nm in diameter) were found in many pores of the cell-seeded and to a less extent cell-free scaffolds (Figs. ai and di, representing higher magnifications i.e. × 50,000 of Figs. 5a and 5d respectively). Moreover, the density of newly formed CaP phase seemed to increase over time, from D14 to D48. EDS spectra (g, h) show the calcium (Ca) to phosphorus (P) ratio inside the cell-free and cell-loaded constructs, respectively. XRD analysis of the cell-free and cell-seeded scaffolds confirmed the presence of hydroxyapatite ( Fig. 6 a–f). All diffractograms showed the characteristic peaks for nanocrystalline HA and a small amorphous halo at 2 Θ = 20° caused by the organic component of the scaffolds (CS/Gel). The calculated lattice parameters of incorporated HA ( a = 9.44 and c = 6.89 Å) agreed well those of pure HA ( a = 9.42 and c = 6.88 Å). The determined crystallite size ( D = 50 nm) confirmed the nanocrystalline nature of HA. It must be noted that from the XRD data, it was not possible to detect the newly formed (biomineralized) CaP phase because it was masked by the dominant part of the nHA that was already incorporated during the synthesis. Additionally, it has to be considered that the sample mass (powder) needed for the XRD measurement was not the same for all samples so that a direct intensity comparison of the diffractograms is not possible. Fig. 6 Representative X-ray powder diffractograms (XRD) of the cell-free (a-c) and the cell-free (d-f) CS/Gel/nHA scaffolds after 14, 28, and 48 days in culture. 4 Discussion Scaffolds constitute the keystone of dental tissue regenerative strategies by acting as carriers of bioactive molecules and competent cells. Among those, polymer-based hydrogels, either natural or synthetic, have been extensively employed for the regeneration of the components of the dentin/pulp complex, due to several beneficial properties, such as tunable viscosity, and microporous structure, mimicking the natural ECM [ ]. Until now, collagen scaffolds, functionalized with bioactive molecules, such as BMP, SDF-1, and G-CSF, as well as scaffolds based on other natural matrices, such as fibrin- or PRF (platelet-rich fibrin) have been successfully employed, but mainly targeting regeneration of the soft pulp tissue component [ ]. Other well-established pro-regenerative polymers, such as chitosan, alginate, and poly( ε -caprolactone) (PCL), have been applied to address the regeneration challenges of the mineralized dentin tissue component, but with limited results. In this respect, efforts to associate different types of natural polymers together with inorganic elements in the same scaffold have emerged to add advantages or to offset a disadvantage of a single material. Towards this direction, the merits of the synergetic effects of biomimetic natural blends of chitosan, gelatin, and hydroxyapatite have been verified by previous studies targeting bone regeneration [ , , ]. Nevertheless, to the best of our knowledge, the present study was the first to combine CS/Gel/nHA scaffolds with dental tissue-derived MSCs, which represent the most well-established cell source for mineralized dental tissue regeneration. Previous studies have demonstrated that CS/Gel/HA blends remarkably favor cell attachment and proliferation [ , , ]. In line with these results, our study showed that the synthesized by the freeze-drying technique CS/Gel/nHA scaffolds at the proposed composition containing 55% w/v nHA, and a low concentration of the crosslinking agent glutaraldehyde of 0.1% v/v, efficiently supported initial DPSC adhesion, and long-term maintenance of cell viability up to 14th day in culture, as evidenced by the SEM analysis and live/dead fluorescent staining respectively. The metabolic-based test (MTT assay) performed on DPSC-seeded scaffolds, showed an increase of cell viability until day 3, followed, however, by a decrease in OD values on D7 and D14. These, at first glance, contradictory to the live/dead staining results, can be interpreted by the mitochondrial function and metabolic changes occurring during induction of stem cell differentiation in culture, as also confirmed by previous studies [ ]. The latter is evidenced in the present study by the substantial upregulation in the expression of odontogenesis-related genes, such as BMP-2 and the dentin-specific odontogenic marker DSSP , that occurred under the influence of the biomimetic microenvironment of the hybrid scaffolds beginning on day 3 after seeding. Notably, this was accomplished without the need for exogenous addition of any inductive factors, as it was the case in similar studies [ ]. The biological properties of the scaffolds are affected by several parameters, including the scaffold architecture, the total porosity, the pore size, and the pore interconnection. In this study, the application of freeze-drying resulted in the production of scaffolds with pore sizes between 70−120 μm. The proposed pore size has been demonstrated to favor the adhesion and proliferation of various types of MSCs, as compared to larger pore sizes up to 200 μm [ ]. The pores of the scaffold appeared to be spherical and interconnected. The high porosity of the CS/Gel/nHA scaffold combined with the presence of interconnected pores provides better access to the transfer of nutrients for cells, facilitates cell migration into the structure, and enhances tissue ingrowth. Glutaraldehyde (GTA) is a commonly used chemical agent which ensures the maximum possible degree of crosslinking, leading to improved mechanical properties [ ]. GTA-induced toxicity is a possibility that can be eliminated by controlling its concentration in polymeric solution up to 5% [ , ]. A previous study evaluated the viability and attachment properties of DPSCs in CS/Gel scaffolds crosslinked with GTA at different concentrations ranging from 0.1 to 2% (w/v) and pointed out that even a minor increase of the cross-linker concentration, may affect biological properties related to cell osteo/odontogenic differentiation and biomineralization, even if it is not directly toxic to the cells [ ]. The results of the present study showed that the incorporation of nHA inside the CS/Gel scaffolds significantly lowered water absorption. In accordance with our results, swelling studies have been shown a decrease in the swelling ratio with addition of nHA compared to CS/Gel scaffolds without HA [ ], while other studies showed that an increase of HA concentration on CS/Gel/nHA scaffolds is associated with worse degradability and swelling properties [ ]. The water uptake ability of scaffolds is beneficial for TE applications as it facilitates the transport of nutrients and metabolites through materials and the prevention of infections during wound healing through absorbing inflammation liquids. Nevertheless, an excessive water absorption may provoke hydrolysis, microcracks, or even scaffold breakdown. In this respect, the incorporation of nHA and its effect on water uptake is a controversial matter. Sultana et al. found that HA/polymer composite scaffolds had an increased water absorption in comparison to polymer scaffolds without HA [ ]. Thus far, it is not clear which is the appropriate limit of water absorption for each type of scaffold in which the advantages of swelling outweigh the disadvantages. So, the ideal water uptake and diffusion characteristics of the scaffolds needs further investigation. DPSCs represent an up-and-coming source of oral MSCs, with great importance in regenerative dentistry. These cells are known to exhibit high proliferation rates, self-renewal capacity, multilineage differentiation potential, and expression of mesenchymal and embryonic stem cell markers [ ]. In this study, DPSCs were selected because of their high potential for odontogenic differentiation, while in vivo -studies confirmed their ability to reconstitute functional dentin/pulp complexes [ , ]. A previous study has shown that an exogenous application of Bone Morphogenic Protein-2 (BMP-2) or Dentin Matrix Protein (DMP-1) in DPSCs seeded in Mg-based bioceramic scaffolds promoted the biomineralization and the formation of a nanocrystalline HA-rich dentin-like matrix [ ]. In this study, the upregulation of several dentin matrix-related genes provides evidence that the biomimetic CS/Gel/nHA scaffolds promoted odontogenic differentiation of the seeded DPSCs. In particular, the pronounced upregulation in the expression of ALP is indicative of DPSC differentiation towards mineralized matrix-producing cells, since ALP plays a significant role during dentinogenesis by hydrolyzing pyrophosphate to provide inorganic phosphate [ ]. Besides, the pronounced upregulation of DSPP , which is a specific gene related to crystalline phase formation and dentin matrix mineralization [ ], indicates that the proposed CS/Gel/nHA scaffolds support odontogenic shift of DPSCs without exogenous addition of inductive factors [ ]. DSPP is expressed mostly in dentin, but has been also detected in bone at only 1/400th the level as dentin [ ]. It belongs to the SIBLINGs and plays a crucial role in dentinogenesis [ ]. Upregulation of BMP-2 gene expression was also observed and can be associated with dentin matrix production, since BMP-2 is known to activate DSPP expression via NF-Y signaling [ ]. Regarding the transcription factor RunX2 , it has been shown that it is mainly active in the early stages of tooth development and ceases its expression after completion of differentiation of odontoblasts; the latter coincides with the production of mineralized ECM tissue [ , ]. This fact is in line with our findings, as the downregulation of RunX2 on D14 aligns with the upregulation of mineralization-related genes, like DSPP and BMP-2 , but also with a further upregulation of the transcription factor Osterix, which is active even at later stages of dentin production [ , ]. The results of the present study confirmed that mineralized tissue formation inside the proposed CS/Gel/nHA scaffolds is achievable without the need for external application of growth or other inductive factors, such the widely applied dexamethasone. The addition of inorganic (KH 2 PO 4 ) and organic (beta-glycerophosphate) phosphate sources in the culture medium was sufficient for the production of a CaP-rich nanocrystalline phase in both the cell-free and in cell-seeded scaffolds, as shown by the SEM analysis. Net-like connected CaP nanocrystals of about 25−30 nm in diameter were found in many pores of the scaffolds, and the density of newly formed CaP tissue appeared to increase with increasing incubation time. Although mineralization could be observed within the cell-free scaffolds due to chemical precipitation, the amount of newly formed CaP phase, and the pore filling was less compared to the cell-seeded constructs, the latter been indicative of cell-mediated biomineralization. The spontaneous precipitation of a bioactive structure after addition of nHA into CS/Gel scaffolds and immersion in a phosphate solution is very likely to be caused by the interaction between Ca 2+ and PO 4 3− of HA and R-COO- and R-NH 4 + of gelatin and chitosan respectively, leading to a structure of apatite-like nature, as shown in previous studies [ , , , ]. The XRD analysis determined the crystallite size ( D = 50 nm) and showed the characteristic peak of hydroxyapatite around 32° (2 θ ) which appears also in the XRD pattern of natural dentin. Nevertheless, it was not possible to distinguish the cell-produced CaP phase from the dominant part of the nHA that was already incorporated during the initial synthesis of the scaffold. Overall, the results of the present study are following the rationale of previous in vitro studies aiming in TE-based regeneration of biomineralized dental tissues by means of different scaffold-based and scaffold-free approaches [ ]. Despite the above-discussed limitations of the present study, the proposed biomimetic approach provides a microenvironment favoring odontogenic differentiation and in vitro biomineralization without the addition of any inductive factors. The ultimate goal would be the production of tubular dentin. Sparse efforts have been performed to this direction by combining bioactive nanohybrid scaffolds made by synthetic polymers, e.g. (poly(ethylmethacrylate- co -hydroxyethylacrylate), and coated with HA in an in ectopic in vivo model [ ], or by applying laser-assisted micropatterning to fabricate gelatin-based tubular microstructures [ ]; these results, however, need further characterization regarding the potential of in vitro and in vivo biomineralization, before they can be considered for clinical application in humans. 5 Conclusions In the present study, odontogenic differentiation and mineralization was achieved by combining CS/Gel/nHA scaffolds prepared by freeze-drying with dental-tissue derived stem cells (DPSCs). The high porosity of the scaffolds, combined with the application of a biocompatible blend of natural polymers (chitosan and gelatin) made them beneficial for initial cell attachment, long-term preservation of cell viability, and odontogenic differentiation of the DPSCs. Furthermore, the incorporation of hydroxyapatite nanoparticles (nHA), which represent the main inorganic component of natural dentin, promoted the deposition of a nanocrystalline mineralized tissue inside the cell-free and (to higher extent) inside the cell-seeded scaffolds. In contrast to previous studies, the proposed biomimetic approach of mineralized tissue formation without the need for exogenous addition of inductive factors is a promising approach towards TE-based dental tissue regeneration. Author contributions MT, GV, and EP performed the biological experiments, including establishment and characterization of DPSCs, cell-seeding of the scaffolds, analysis of cell morphology, viability, odontogenic differentiation, and in vitro biomineralization. MT and GV also drafted the manuscript. AG synthesized and characterized the scaffolds and performed preliminary biological experiments on the viability of the pre-osteoblastic cells. OP performed the SEM, EDS, and XRD analysis of the samples after the completion of the in vitro biomineralization experiments and participated in the drafting of the manuscript. ME supervised the SEM, EDS and XRD experiments and critically reviewed the manuscript. AK supervised the flow cytometry experiments and critically reviewed the manuscript. AB, MC, conceived the study, supervised the experiments, analyzed and interpreted the data, participated in drafting and critically reviewing the manuscript. PK supervised the experiments, interpreted the data and critically reviewed the manuscript. All authors read and approved the manuscript in final form. Funding We acknowledge financial support from the General Secretariat for Research and Technology Aristeia II Grant ‘Osteobiomimesis 3438’ MIS 525089. Datasets are available on request The raw data supporting the conclusions of this manuscript will be made available by the authors, without undue reservation, to any qualified researcher Acknowledgments This study was conducted with financial support of the General Secretariat for Research and Technology (GSRT) grant Excellence II (Project: Osteobiomimesis, MIS 525089), the European Union (EU) and National Resources. 1 These authors have contributed equally to this work. References 1. Atai Z., Atai M.: Side effects and complications of dental materials on oral cavity. Am J Appl Sci Res 2007; 4: pp. 946-949. 2. Bakopoulou A., Papadopoulos T., Garefis P.: Molecular toxicology of substances released from resin-based dental restorative materials. Int J Mol Sci 2009; 10: pp. 861-899. 3. Sailer I., Makarov N.A., Thoma D.S., Zwahlen M., Pjetursson B.E.: All-ceramic or metal-ceramic tooth-supported fixed dental prostheses (FDPs)? A systematic review of the survival and complication rates. Part I: Single crowns (SCs). Dent Mater 2015; 31: pp. 603-623. 4. Bakopoulou A., Papachristou E., Bousnaki M., Hadjichristou C., Kontonasaki E., Theocharidou A., et. al.: Human treated dentin matrices combined with Zn-doped, Mg-based bioceramic scaffolds and human dental pulp stem cells towards targeted dentin regeneration. Dent Mater 2016; 32: pp. e159-75. 5. Wang F., Xie C., Ren N., Bai S., Zhao Y.: Human freeze-dried dentin matrix as a biologically active scaffold for tooth tissue engineering. J Endod 2019; 45: pp. 1321-1331. 6. Nakashima M., Iohara K.: Mobilized dental pulp stem cells for pulp regeneration: initiation of clinical trial. J Endod 2014; 40: pp. S26-32. 7. Wei F., Song T., Ding G., Xu J., Liu Y., Liu D., et. al.: Functional tooth restoration by allogeneic mesenchymal stem cell-based bio-root regeneration in swine. Stem Cells Dev 2013; 22: pp. 1752-1762. 8. Gao Z.H., Hu L., Liu G.L., Wei F.L., Liu Y., Liu Z.H., et. al.: Bio-root and implant-based restoration as a tooth replacement alternative. J Dent Res 2016; 95: pp. 642-649. 9. Modino S.A., Sharpe P.T.: Tissue engineering of teeth using adult stem cells. Arch Oral Biol 2005; 50: pp. 255-258. 10. Oshima M., Mizuno M., Imamura A., Ogawa M., Yasukawa M., Yamazaki H., et. al.: Functional tooth regeneration using a bioengineered tooth unit as a mature organ replacement regenerative therapy. PLoS One 2011; 6: 11. Sharma S., Srivastava D., Grover S., Sharma V.: Biomaterials in tooth tissue engineering: a review. J Clin Diagn Res 2014; 8: pp. 309-315. 12. Hashemi-Beni B., Khoroushi M., Foroughi M.R., Karbasi S., Khademi A.A.: Tissue engineering: dentin – pulp complex regeneration approaches (A review). Tissue Cell 2017; 49: pp. 552-564. 13. Monteiro N., Yelick P.C.: Advances and perspectives in tooth tissue engineering. J Tissue Eng Regen Med 2017; 11: pp. 2443-2461. 14. Goldberg M., Kulkarni A.B., Young M., Boskey A.: Dentin: structure, composition and mineralization. Front Biosci (Elite Ed) 2011; 3: pp. 711-735. Review 15. Fisher L.W., Fedarko N.S.: Six genes expressed in bones and teeth encode the current members of the SIBLING family of proteins. Connect Tissue Res 2003; 44: pp. 33-aa40. 16. Bakopoulou A., Georgopoulou A., Grivas I., Bekiari C., Prymak O., Loza K., et. al.: Dental pulp stem cells in chitosan/gelatin scaffolds for enhanced orofacial bone regeneration. Dent Mater 2019; 35: pp. 310-327. 17. Rao R.R., Stegemann J.P.: Cell-based approaches to the engineering of vascularized bone tissue. Cytotherapy 2013; 15: pp. 1309-1322. 18. Isikli C., Hasirci V., Hasirci N.: Development of porous chitosan-gelatin/hydroxyapatite composite scaffolds for hard tissue-engineering applications. J Tissue Eng Regen Med 2012; 6: pp. 135-143. 19. Georgopoulou A., Papadogiannis F., Batsali A., Marakis J., Alpantaki K., Eliopoulos A.G., et. al.: Chitosan/gelatin scaffolds support bone regeneration. J Mater Sci Mater Med 2018; 29: pp. 59. 20. Perinelli D.R., Fagioli L., Campana R., Lam J.K.W., Baffone W., Palmieri G.F., et. al.: Chitosan-based nanosystems and their exploited antimicrobial activity. Eur J Pharm Sci 2018; 117: pp. 8-20. 21. Chiono V., Pulieri E., Vozzi G., Ciardelli G., Ahluwalia A., Giusti P.: Genipin-crosslinked chitosan/gelatin blends for biomedical applications. J Mater Sci Mater Med 2008; 19: pp. 889-898. 22. Muzzarelli R.A.A., Mehtedi M., Bottegoni C., Aquili A., Gigante A.: Genipin-crosslinked chitosan gels and scaffolds for tissue engineering and regeneration of cartilage and bone. Mar Drugs 2015; 13: pp. 7314-7338. 23. Costa-Pinto A.R., Reis R.L., Neves N.M.: Scaffolds based bone tissue engineering: the role of chitosan. Tissue Eng B Rev 2011; 17: pp. 331-347. 24. Huang Y., Onyeri S., Siewe M., Moshfeghian A., Madihally S.V.: In vitro characterization of chitosan-gelatin scaffolds for tissue engineering. Biomaterials 2005; 26: pp. 7616-7627. 25. Lien S.M., Ko L.Y., Huang T.J.: Effect of pore size on ECM secretion and cell growth in gelatin scaffold for articular cartilage tissue engineering. Acta Biomater 2009; 5: pp. 670-679. 26. Moussa D.G., Aparicio C.: Present and future of tissue engineering scaffolds for dentin-pulp complex regeneration. J Tissue Eng Regen Med 2019; 13: pp. 58-75. 27. Zhao F., Grayson W.L., Ma T., Bunnell B., Lu W.W.: Effects of hydroxyapatite in 3-D chitosan-gelatin polymer network on human mesenchymal stem cell construct development. Bioma Terials 2006; 27: pp. 1859-1867. 28. Thein-Han W., Misra R.D.: Biomimetic chitosan–nanohydroxyapatite composite scaffolds for bone tissue engineering. Acta Biomater 2009; 5: pp. 1182-1197. 29. Rajkumar M., Kavitha K., Prabhu M., Meenakshisundaram N., Rajendran V.: Nanohydroxyapatite–chitosan–gelatin polyelectrolyte complex with enhanced mechanical and bioactivity. Mater Sci Eng C Mater Biol Appl 2013; 33: pp. 3237-3244. 30. Li J., Dou Y., Yang J., Yin Y., Zhang H., Yao F., et. al.: Surface characterization and biocompatibility of micro- and nano-hydroxyapatite/chitosan-gelatin network films. Mater Sci Eng C 2009; 29: pp. 1207-1215. 31. Ji J., Tong X., Huang X., Wang T., Lin Z., Cao Y., et. al.: Sphere-shaped nano-hydroxyapatite/chitosan/gelatin 3D porous scaffolds increase proliferation and osteogenic differentiation of human induced pluripotent stem cells from gingival fibroblasts. Biomed Mater 2015; 10: pp. 045005. 32. Rajkumar M., Kavitha K., Prabhu M., Meenakshisundaram N., Rajendran V.: Nanohydroxyapatite–chitosan–gelatin polyelectrolyte complex with enhanced mechanical and bioactivity. Mater Sci Eng C Mater Biol Appl 2013; 33: pp. 3237-3244. 33. Yan M., Yu Y., Zhang G., Tang C., Yu J.: A journey from dental pulp stem cells to a bio-tooth. Stem Cell Rev 2011; 7: pp. 161-171. 34. Bousnaki M., Bakopoulou A., Papadogianni D., Barkoula N.M., Alpantaki K., Kritis A., et. al.: Fibro/chondrogenic differentiation of dental stem cells into chitosan/alginate scaffolds towards temporomandibular joint disc regeneration. J Mater Sci Mater Med 2018; 29: pp. 97. 35. Parkatzidis K., Chatzinikolaidou M., Kaliva M., Bakopoulou A., Farsari M., Vamvakaki M.: Multiphoton 3D printing of biopolymer-based hydrogels. ACS Biomater Sci Eng 2019; 5: pp. 6161-6170. 36. Egusa H., Sonoyama W., Nishimura M., Atsuta I., Akiyama K.: Stem cells in dentistry – part I: stem cell sources. J Prosthodont Res 2012; 56: pp. 151-165. 37. Gronthos S., Mankani M., Brahim J., Robey P.G.S.S.: Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci U S A 2000; 97: pp. 13625-13630. 38. Zein N., Harmouch E., Lutz J., De Grado G.F., Kuchler-bopp S., Clauss F., et. al.: Polymer-based instructive scaffolds for endodontic regeneration. Materials (Basel) 2019; 12: pp. E2347. 39. Sellgren K.L., Ma T.: Perfusion conditioning of hydroxyapatite-chitosan-gelatin scaffolds for bone tissue regeneration from human mesenchymal stem cells. J Tissue Eng Regen Med 2012; 6: pp. 49-59. 40. Qu T., Jing J., Jiang Y., Taylor R.J., Feng J.Q., Geiger B., et. al.: Magnesium-containing nanostructured hybrid scaffolds for enhanced dentin regeneration. Tissue Eng A 2014; 20: pp. 2422-2433. 41. Chatzinikolaidou M., Pontikoglou C., Terzaki K., Kaliva M., Kalyva A., Papadaki E., et. al.: Recombinant human bone morphogenetic protein 2 (rhBMP-2) immobilized on laser-fabricated 3D scaffolds enhance osteogenesis. Colloids Surf B Biointerfaces 2017; 149: pp. 233-242. 42. Oryan A., Kamali A., Moshiri A., Baharvand H., Daemi H.: Chemical crosslinking of biopolymeric scaffolds: current knowledge and future directions of crosslinked engineered bone scaffolds. Int J Biol Macromol 2018; 107: pp. 678-688. 43. Guldner N.W., Jasmund I., Zimmermann H., Heinlein M., Girndt B., Meier V., et. al.: Detoxification and endothelialization of glutaraldehyde-fixed bovine pericardium with titanium coating: a new technology for cardiovascular tissue engineering. Circulation 2009; 119: pp. 1653-1660. 44. Mathew P., Ganesh N., Selvamurugan N., Nair S.V., Furuike T., Tamura H., et. al.: Preparation and characterization of chitosan–gelatin/nanohydroxyapatite composite scaffolds for tissue engineering applications. Carbohydr Polym 2010; 80: pp. 687-694. 45. Wattanutchariya W., Whattanapong C.: Characterization of porous scaffold from Chitosan-Gelatin/Hydroxyapatite for bone grafting. IMECS 2014; Hong Kong 46. Sultana N., Khan T.: Water absorption and diffusion characteristics of nanohydroxyapatite (nHA) and poly(hydroxybutyrate-co-hydroxyvalerate-) based CompositeTissue engineering scaffolds and nonporous thin films. J Nanomater 2013; 9: pp. 801-809. 47. Kim S., Shin S.J., Song Y., Kim E.: In vivo experiments with dental pulp stem cells for pulp-dentin complex regeneration. Mediat Inflamm 2015; 2015: pp. 409347. 48. Bourd-Boittin K., Fridman R., Fanchon S., Septier D., Goldberg M., Menashi S.: Matrix metalloproteinase inhibition impairs the processing, formation and mineralization of dental tissues during mouse molar development. Exp Cell Res 2005; 304: pp. 493-505. 49. Zhang Q., Lu H., Kawazoe N., Chen G.: Preparation of collagen scaffolds with controlled pore structures and improved mechanical property for cartilage tissue engineering. J Bioact Compat Polym 2013; 28: pp. 233-245. 50. Danilevicius P., Rezende R.A., Pereira F.D., Selimis A., Kasyanov V., Noritomi P.Y., et. al.: Burr-like, laser-made 3D microscaffolds for tissue spheroid encagement. Biointerphases 2015; 10: pp. 021011. 51. Huang B., Sun Y., Maciejewska I., Qin D., Peng T., McIntyre B., et. al.: Distribution of SIBLING proteins in the organic and inorganic phases of rat dentin and bone. Eur J Oral Sci 2008; 116: pp. 104-112. 52. Fisher L.W., Fedarko N.S.: Six genes expressed in bones and teeth encode the current members of the SIBLING family of proteins. Connect Tissue Res 2003; 44: pp. 33-40. 53. Chen S., Gluhak-Heinrich J., Martinez M., Li T., Wu Y., Chuang H.H., et. al.: Bone morphogenetic protein 2 mediates dentin sialophosphoprotein expression and odontoblast differentiation via NF-Y signaling. J Biol Chem 2008; 283: pp. 19359-19370. 54. Cheng N.C., Wang S., Young T.H.: The influence of spheroid formation of human adipose-derived stem cells on chitosan films on stemness and differentiation capabilities. Biomaterials 2012; 33: pp. 1748-1758. 55. Hsu S.H., Huang G.S., Feng F.: Isolation of the multipotent MSC subpopulation from human gingival fibroblasts by culturing on chitosan membranes. Biomaterials 2012; 33: pp. 2642-2655. 56. Tsaia W.B., Chena R.Y., Liub S.L., Lai J.: Fabrication of UV-crosslinked chitosan scaffolds with conjugation of RGD peptides for bone tissue engineering. Carbohydr Polym 2011; 85: pp. 129-137. 57. Yeh H.Y., Liu B.H., Sieber M., Hsu S.H.: Substrate-dependent gene regulation of self-assembled human MSC spheroids on chitosan membranes. BMC Genomics 2014; 15: pp. 10. 58. Li J., Chen Y., Yin Y., Yao F., Yao K.: Modulation of nano-hydroxyapatite size via formation on chitosan-gelatin network film in situ. Biomaterials 2007; 28: pp. 781-790. 59. Moonesi Rad R., Pazarçeviren E., Akgün Ece, Evis Z., Keskin D., Şahin S., et. al.: In vitro performance of a nanobiocomposite scaffold containing boron-modified bioactive glass nanoparticles for dentin regeneration. J Biomater Appl 2019; 33: pp. 834-853. 60. Yang X., Zhang S., Pang X., Fan M.: Mineralized tissue formation by bone morphogenetic protein-7-transfected pulp stem cells. J Endod 2012; 38: pp. 170-176. 61. Iohara K., Nakashima M., Ito M., Ishikawa M., Nakasima A., Akamine A.: Dentin regeneration by dental pulp stem cell therapy with recombinant human bone morphogenetic protein 2. J Dent Res 2004; 83: pp. 590-595. 62. He G., Dahl T., Veis A., George A.: Nucleation of apatite crystals in vitro by self-assembled dentin matrix protein 1. Nat Mater 2003; 2: pp. 552-558. 63. Vallés-Lluch A., Novella-Maestre E., Sancho-Tello M., Pradas M.M., Ferrer G.G., Batalla C.C.: Mimicking natural dentin using bioactive nanohybrid scaffolds for dentinal tissue engineering. Tissue Eng A 2010; 16: pp. 2783-2793. 64. Ma C., Qu T., Chang B., Jing Y., Feng J.Q., Liu X.: 3D maskless micropatterning for regeneration of highly organized tubular tissues. Adv Healthc Mater 2018; 7:

Related Articles

Leave A Comment?

You must be logged in to post a comment.