Photodynamic inactivation of Streptococcus mutans by curcumin in combination with EDTA

You're Reading a Preview

Become a DentistryKey membership for Full access and enjoy Unlimited articles

Become membership

If you are a member. Log in here

Was this article helpful?

Photodynamic inactivation of Streptococcus mutans by curcumin in combination with EDTA Gabriel Nima , Jorge Soto-Montero , Lívia A. Alves , Renata O. Mattos-Graner and Marcelo Giannini Dental Materials, 2021-01-01, Volume 37, Issue 1, Pages e1-e14, Copyright © 2020 The Academy of Dental Materials Highlights Curcumin-mediated PDI with EDTA fully inactivated S. mutans in planktonic culture. The use of EDTA increases damage on the bacterial structure. High curcumin concentrations are less effective than the lower ones. The energy delivered to the photosensitizer is key for the bacteria inactivation. Curcumin-mediated PDI could be a promising technique for dental tissue disinfection. Abstract Objective This study aimed to test the efficacy of photodynamic inactivation (PDI) mediated by curcumin with EDTA against Streptococcus mutans in planktonic suspension using blue LED light. Methods Antibacterial activity of curcumin and EDTA was evaluated by determination of their minimal inhibitory concentration (MIC) and minimal bactericidal concentration (MBC). The fractional inhibitory concentration index (FICI) was used to estimate the synergistic effect of various combination ratios of curcumin and EDTA against S. mutans . Cultures of S. mutans (18 h, 37 °C, 5% C0 2 ) were prepared to test the effect of curcumin-mediated PDI (50 μM and 500 μM) with or without 0.4% EDTA and 40 s of light-activation with blue light. EDTA and each concentration of curcumin were also tested individually. Chlorhexidine (0.2%), was used as positive control. Planktonic suspensions were also analyzed by viable colony counts (VCC), confocal laser scanning microscopy (CLSM), transmission electron microscopy (TEM), and polymerase chain reaction (PCR). Results The MIC values of curcumin and EDTA were 5 mM and 0.125% respectively. FICI showed a synergistic interaction between curcumin and EDTA. All the combinations with curcumin and blue LED light resulted in a complete inactivation of the S. mutans and CLSM confirms these results, TEM showed morphological changes produced by the PDI. No damage on DNA structure was detected by PCR. Significance Curcumin-mediated PDI with EDTA using a blue light, shows a strong inhibitory effect against S. mutans in planktonic culture. Because of the unspecific target mechanism, it could be a promising technique for disinfection of dental tissues. 1 Introduction Streptococcus mutans is an endogenous bacteria of the oral cavity,considered the primary causing agent of dental caries [ , ]. S. mutans has the ability to metabolize dietary carbohydrates to form acids, producing demineralization of dental hard tissues and developing extracellular polysaccharides by the action of their glucosyltransferases [ , ]. Clinically, management of dental caries is done by removing contaminated and demineralized dentin tissue [ ] and bacterial remnants can lead to problems such as dental sensitivity, pulpal inflammation and secondary caries. To ensure complete dentinal disinfection, various antibacterial agents such as chlorhexidine have been indicated for use before placing a restoration, with good reported results [ ]. However, the use of disinfecting agents has been associated to reduced bond strength to dentin [ , ], increased microleakage [ ], marginal staining, and bacterial resistance [ , ]. Therefore, new therapies for decontamination of oral tissues without the adverse side effects of the traditional methods are of great interest in dentistry [ ]. Photodynamic therapy (PDT) uses light to activate a photosensitizing agent in the presence of oxygen, resulting in the production of reactive oxygen species (ROS) to damage abnormal cells [ , ]. PDT has been successfully used in dermatology, oncology, gynecology, and urology [ ], and can also inactivate bacteria in a process that has been called photodynamic inactivation (PDI) or photodynamic antimicrobial therapy. Thus, the antimicrobial efficacy of PDI is based on liberation of ROS that cause damage to bacteria structures [ ]. PDI has an unspecific mechanism of action reducing the possibility to develop bacterial resistance. At this moment, PDI has been used in dentistry to inactivate fungi and oral bacteria [ ], sometimes combined with natural photosensitizers. Among the tested natural photosensitizers, curcumin has been used as anti-inflammatory, anti-oxidant, antidiabetic, and anticarcinogenic [ ]. Curcumin is a yellow, phenolic compound, extracted from Curcuma longa, widely used for seasoning [ , ], that has been recently used as a photosensitizing agent in PDI to inactivate bacteria including cariogenic oral bacteria [ ]. Curcumin has a broad absorption range (300–500 nm), compatible with dental blue light curing units [ , , ]. The combined administration of antibacterial agents with potentializing or sensitizing agents has gained interest because it often leads to synergistic effects [ ]. Ethylene-diamine-tetra-acetic acid (EDTA) has been used successfully to potentiate the efficacy of antibiotics [ ] and photosensitizers [ ]. EDTA alters the permeability of the cell wall of bacteria by chelating calcium and magnesium ions [ , ]. These ions play a fundamental role protecting the bacterial cell walls and their removal by EDTA might weaken their structure facilitating the accessibility of other drugs [ , ]. The combination of curcumin with EDTA may enhance the passage of the photosensitizer through the cellular membrane, increasing its phototoxic effect on bacteria [ ]. To our knowledge, only one study has evaluated the benefits produced by the combination of curcumin with EDTA against dental biofilm [ ]. In order to improve the knowledge about the potential disinfecting effect of the combination of curcumin with EDTA in dental tissues, the purpose of this study was to test the efficacy of curcumin-mediated PDI with EDTA against S. mutans in planktonic suspension using a blue light source. The null hypothesis tested were that (1) curcumin-EDTA would not have a synergic antibacterial effect against S. mutans ; (2) curcumin-EDTA mediated PDI would not have an antibacterial effect against S. mutans in planktonic suspension; (3) curcumin-EDTA mediated PDI would not have a significant effect on the cellular integrity of S. mutans in planktonic suspension; and (4) curcumin-EDTA mediated PDI would not produce DNA damage against S. mutans in planktonic suspension. 2 Materials and methods 2.1 Bacterial strain and growth conditions The experiments were performed using the S. mutans (reference strain UA159) obtained from the laboratory of Microbiology and Immunology of the Piracicaba Dental School (University of Campinas, Piracicaba, Brazil). The bacterial culture was stored at −70 °C in BHI medium (Difco Laboratories, Detroit, MI, USA) containing 20% ( v /V) glycerol until needed. 2.2 Photosensitizer Curcumin (Sigma-Aldrich, S. Louis, MO, USA) was used as a photosensitizing. A stock solution of curcumin (20 mM) was prepared in ethanol (Merck Millipore Corporation, Darmstadt, Germany). In the same way, a 5% stock solution of EDTA (USB Corporation, Cleveland, OH, USA) was prepared in saline solution. Both solutions were filtered (0.22 μm pore size filter, Kasvi; São José do Pinhais, PR, Brazil), aliquoted and stored at −20 °C in dark conditions until usage. The stock solutions were diluted in saline solution to obtain the final concentrations to be tested. 2.3 Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) The antimicrobial activity of curcumin and EDTA was evaluated by determining their Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC). Cultures of S. mutans grown in THB culture medium supplemented with 0.3% yeast extract (THY) for 18 h at 37 °C and 5% CO 2 . The cultures were measured for optical density at (OD600) ≥0.900 and adjusted to 0.06 with fresh THY medium. Curcumin was diluted from 20 mM to 312.5 μM and EDTA was diluted from 2% to 0.015%. One hundred microliters of the adjusted inoculum were mixed with 100 μL of each curcumin or EDTA dilutions. Plates were incubated at 37 °C and 5% CO 2 for 24 h. After incubation, the row of wells with the lowest dilution showing no turbidity was defined as the MIC, to confirm the results a resazurin method was used [ ]. A dilution of resazurin sodium salt (Sigma-Aldrich, S. Louis, MO, USA) (0.1%) was added to all wells (50 μL per well), and further incubated for 4 h at 37 °C and 5% CO 2 in dark conditions for the observation of color change. The MBC was determined by plating in triplicate 10 μL the content of the wells with concentrations 2 times higher than the MIC, before to the staining with resazurin. The MBC value was determined by plating on agar the lowest concentration of the extracts required to kill 99.9% of bacteria from the initial inoculum. Three series of independent experiments were performed for MIC and MBC. 2.4 Fractional inhibitory concentration (FIC) and fractional inhibitory concentration index (FICI) The synergistic combinations between curcumin and EDTA were investigated using the fractional inhibitory concentration index (FICI) adapting the method described by Vuuren at al. [ ]. The MIC values of curcumin and EDTA were used as starting stock concentrations and were diluted in five different ratios (9:1, 7:3, 5:5, 3:7, 1:9). The MIC of each combination was obtained using the protocol described above. The following equations were used to calculate the FIC values for EDTA and curcumin. FIC(Curcumin)=MIC value of combined curcumin/EDTAMIC value of curcumin alone FI C ( Curcumin ) = MIC value of combined curcumin/EDTA MIC value of curcumin alone FIC(EDTA)=MIC value of combined curcumin/EDTAMIC value of EDTA alone FI C ( EDTA ) = MIC value of combined curcumin/EDTA MIC value of EDTA alone Finally, the FICI of each combination were calculated based on the FIC values where FICI resulted by the sum of FIC (curcumin) and FIC (EDTA). The interaction was graded as: FICI < 1, synergy; FICI = 1, additive and FICI > 1, antagonistic [ ]. Three series of independent experiments were performed. 2.5 Light source A polywave light emitting diode curing unit (Bluephase G2; Ivoclar Vivadent, Schaan, Liechtenstein) was used in this study to excite the curcumin. This light-curing unit (LCU) has a 10-mm external diameter light guide with 9-mm internal active diameter. Information about the radiant emission spectrum, emittance and irradiance was obtained using a spectrophotometer (MSC 15 W, SN 37,560; Gigahertz-Optick, Amesbury, MA, USA) coupled to a software (MSC 15 Measurement Software v. 2019.1.0; Gigahertz-Optick, Amesbury, MA, USA). The LCU has a radiant emittance of 1275 mW/cm 2 at high power setting mode, providing a light emission ranking between 385–515 nm with two peak lights in 409 and 454 nm. Characteristic emission spectrum is shown in Fig. 1 . The lamp was fixed in a clamp and the tip of the light guide was positioned perpendicular to the culture in the well with an area of 0.95 cm 2 at 1 mm distance, for an irradiance of 839 mW/cm 2 . Samples were irradiated twice for 20 s cycle with an interval between cycles of 5 s, for a final radiant exposure of 33.5 J/cm 2 . The radiant exposure was calculated as the product of the irradiance multiplied by the total time of exposure (40 s). Fig. 1 (A) Emission spectrum from of the polywave Bluephase Style LCU with peaks on 409 nm and 456 nm and (B) absorption spectrum of curcumin dye. 2.6 Experimental groups The effect of combination of the EDTA (0.4%) and the curcumin (50 μM and 500 μM) were tested with and without photoactivation on S. mutans planktonic culture. In the same way, the saline solution (negative control), EDTA, and each concentration of curcumin were also tested individually with and without photoactivation. Chlorhexidine gluconate (0.2% - Sigma-Aldrich, S. Louis, MO, USA) was used as positive antimicrobial control because it has been long recognized as potent bactericidal for chemical plaque control [ ]. 2.7 Photoinactivation assay in planktonic culture Cultures of S. mutans were grown in THY culture medium (18 h, 37 °C and 5% CO 2 ), measured for optical density at (OD600) ≥0.900 and used for inoculum. On the day of the experiment, the stock solution of curcumin was diluted in sterile saline to concentrations of 1 mM and 100 μM to give a final tested concentration of 500 μM and 50 μM. For EDTA, the stock solution was diluted in saline solution to concentration of 0.8%, chlorhexidine was diluted in sterile water to concentration of 0.4%, to obtain the final tested concentration of 0.4% and 0.2%, respectively. Aliquots of 150 μL of S. mutans planktonic solution were individually transferred to separate wells of a 48-well plate (Kasvi; São José do Pinhais, PR, Brazil) to avoid light contamination and divided in 13 groups (n = 4). Aliquots (150 μL) of the treatment solution were added to the wells containing the microorganism. For saline solution group, 150 μL of sterile saline solution was added. In the groups that received light treatment, the irradiation was applied after dark incubation for 3 min (pre-irradiation time). 2.8 Viable colony counts (VCC) After treatment, 200 μL of the resulting bacterial suspension were serially diluted. Six, ten-fold serial dilutions were carried out for all the samples. Finally, aliquots (10 μL) of each dilution were plated in triplicate on THY plates. The colony-forming units (CFU) values were calculated after the plates were incubated (48 h, 37 °C, 5% CO 2 ). Three series of independent experiments were performed. 2.9 Transmission electron microscopy (TEM) A set of samples (n = 2) was prepared following the procedures described in the section 2.6 and 2.7. The samples of each group were pooled in 1.5 mL Eppendorf tubes. Then the tubes were centrifugated for 1 min at 6000 rcf at 4 °C and washed twice in saline solution. The samples were fixed in Karnovsky’s solution, with post-fixation in 1% osmium tetroxide in 0.2 M Sorensen’s phosphate buffer. Samples were washed with the same buffer, dehydrated in a graded acetone series and embedded in Spurr’s resin. Thin sections of the specimens were stained with uranyl acetate. Finally, the grids were exanimated by TEM (JEM-1400, JEOL, Tokyo, Japan). 2.10 Live and dead cell assay A set of samples (n = 2) were prepared following the procedures described in the section 2.6 and 2.7. The cultures were stained using a live/dead BacLight Bacterial Viability Kit (Life technologies, Carlsbad, CA, USA). Live/dead stain was prepared by diluting 1 μL of SYTO9 (excitation (λ) = 485 nm, emission = 498 nm) and 1 μL of propidium iodide (excitation (λ) = 535 nm, emission = 617 nm) in 1 mL of distilled water. Tubes containing the treated culture were centrifugated for 1 min at 5000 rcf and washed in 1 mL saline solution. The process was repeated twice. Then, the culture was resuspended with 100 μL of staining solution and stored at 37 °C for 30 min. Then, the bacteria cultures were analyzed by confocal laser scanning microscopy (CLSM). A series of images were obtained in the Z section (0,5 μm) using a confocal laser scanning microscope (TCS SP5 MP, Leica Microsystems, Inc., USA). 2.11 Genomic DNA extraction and Polymerase chain reaction (PCR) The genomic DNA damage was evaluated by the amplification of conserved bacterial regions using the 16S rRNA. The PCR was performed using the primers listed on Table 1 . A new set of samples (n = 2) was prepared following the procedures described in the section 2.6 and 2.7. The samples of each group were pooled in 1,5 mL Eppendorf tubes to obtain a higher number of bacteria. Then the tubes were centrifugated for 2 min at 11,000 rcf and 4 °C. The supernatant was carefully discarded to obtain the pellet, the genomic DNA was then extracted using the phenol-chloroform extraction method [ ]. The DNA obtained was quantified by measuring the absorbance at 260 nm. (NanoDrop ND-2000 spectrophotometer – Thermofisher, Waltham, MA, USA). All the PCR reactions (25 μL) were performed with a mix containing 2.5 μL of 1× buffer solution (10× Reaction Buffer Taq Polymerase; INVITROGEN-Life Technologies Brazil; Sao Paulo, SP, Brazil), 1.25 μL of MgCl 2 (50 mM), 0.5 μL of dNTPs (10 mM; DNA Polymerization Mix; INVITROGEN-Life Technologies Brazil; Sao Paulo, SP, Brazil), 0.125 μL of Taq DNA Polymerase (5 U/μL; INVITROGEN- Technologies Brazil; Sao Paulo, SP, Brazil), 0.75 μL of each primer (10 nmol), 1 μL of genomic DNA as template and 18.125 μL of sterile water. Amplification program was performed with a Verity Thermal Cycler (Applied Biosystems; Foster City, CA, USA), with an initial denaturation at 94 °C for 3 min, followed by 30 cycles amplification consisting of denaturalization at 95 °C for 30 s, annealing at 56 °C for 30 s, extension at 72 °C for 90 s and final extension at 72 °C for 10 min. Table 1 Oligonucleotides used in this study. Primer name Sequence 5’-3’ Product size (bp) Aneling temperature Source 16SmutansF GGGTGAGTAACGCGTAGGTA 1401 56 °C This study 16SmutansR TGTTACGACTTCACCCCAAT Electrophoresis was carried out in 0.9% agarose gel, with ethidium bromide (Sigma-Aldrich Corp, St Louis, MO, USA) staining at 110 V for 45 min. PCR product samples (15 μL) were loaded for each well, with Gel Loading Dye, Purple (6×) (New England Biolabs, Ipswich, MA, USA). Three series of independent experiments were performed. 2.12 Statistical analysis Viable colony counts data were tested for normality and homogeneity of variances using Shapiro-Wilk and Levene’s Test ( α = 0.05), which indicated that data set was not normally distributed (p < 0.05). Data were then corrected by using the Box-Cox method (**0.01) and were analyzed by using One-Way ANOVA and Dunnett’s post hoc ( α = 0.05), comparing all the groups with chlorhexidine (positive control). Additionally, Two-Way ANOVA (Treatment*Photoactivation) and Tukey’s post hoc ( α = 0.05) was performed to compare all the groups with and without photoactivation, excluding the chlorhexidine group. Statistical analyses were performed by using SAS software for windows (Version 9.3; SAS Institute, NC, USA). 3 Results The results of the inhibitory effect on S. mutans growth by curcumin and EDTA revealed a dose dependent effect. The MIC for curcumin and EDTA were identified at concentrations of 5 mM and 0.125% (1250 μg/mL), respectively. In addition to the inhibitory effect, the MBC values were investigated, and the same values were obtained for the MBC in both cases. The mean MIC values of the combination profiles of curcumin and EDTA were plotted on an isobologram ( Fig. 2 ) using Microsoft Excel® software. The isobologram provides a graphical representation of the interaction between each combination´s MICs with the independent MICs. In the case of curcumin and EDTA a synergistic effect was observed for all the combinations and the synergy was highest for the ratio 9:1. The FICI values of the tested combinations are presented in Table 2 . A synergistic effect (<1) of FICI = 0.5 was obtained for all the combinations profiles, except for the 9:1 ratio that showed the greatest synergistic effect (FICI = 0.25). Fig. 2 Isobologram showing the synergistic effect of curcumin with EDTA against S. mutans (UA159). The MICs of curcumin and EDTA are represented as a straight line, the MICs of each curcumin:EDTA combination are represented by points. Sinergy, additivity, or antagonism interaction is indicated when the point is located below, on, or above the straight line, respectively. A synergistic effect was observed for all the curcumin:EDTA combinations, the synergy was best noted for the ratio 9:1. Table 2 FICI of curcumin in combination with EDTA where FICI < 1, synergy (S); FICI = 1, additive (A) and FICI > 1, antagonistic (AT). FICI: Curcumin + EDTA 1:9 3:7 5:5 7:3 9:1 S. mutans 0.5 (S) 0.5 (S) 0.5 (S) 0.5 (S) 0.25 (S) Means and standard deviations of the VCC are summarized on Table 3 . One-Way ANOVA showed significant differences [F(12,143) = 84.97; p < 0.0001],between the groups and chlorhexidine group. Photoactivated curcumin groups presented no significant difference regardless the curcumin concentration or the EDTA combination when compared with chlorhexidine group ( Table 3 ). Two-Way ANOVA showed significant for the factors “treatment” [F(5,132) = 42.05; p < 0.0001], “photoactivation” [F(5,132) = 434.01; p < 0.0001], and the interaction “treatment*photoactivation” [F(5,132) = 34.46; p < 0.0001]. No significant differences were found between the groups without photoactivation ( Table 3 ). Table 3 Antibacterial effect of the different treatments on S. mutans planktonic culture (Log CFU/mL). Groups Non-Photoactivated Photoactivated Saline solution 8.21 ± 0.1 Aa * 8.16 ± 0.13 Aa * 0.4% EDTA 8.22 ± 0.1 Aa * 8.18 ± 0.1 Aa * 50 μM Curcumin 8.19 ± 0.09 Aa * 0 Bb 500 μM Curcumin 8.22 ± 0.13 Aa * 0 Bb 50 μM Curcumin + EDTA 8.20 ± 0.08 Aa * 0 Bb 500 μM Curcumin + EDTA 8.16 ± 0.06 Aa * 0 Bb 0.2% Chlorhexidine 0 Means followed by similar letters (upper case letters compare treatments for the same light condition, while lower case letters compare light conditions for the same treatment) indicate no significant difference by two-way ANOVA and post-hoc Tukey’s test (p > 0.05). * Indicates difference with chlorhexidine group by one-way ANOVA and post-hoc Dunnett’s test (p > 0.05). Live/Dead analysis was performed by CLSM on the S. mutans planktonic culture after PDI treatments and the representative images of the experimental groups are shown in Figs. 3 and 4 . Qualitative confocal analysis clearly demonstrated that PDI using curcumin was effective. All the photoactivated curcumin treated samples showed higher number of non-viable bacteria than the saline solution and EDTA groups, regardless the concentration or the combination with EDTA. The treatment with 0.2% chlorhexidine resulted in dead bacteria as well ( Fig. 4 ). For the groups treated with Curcumin combined or not with EDTA, and without photoactivation, a greater number of non-viable bacteria were observed when compared with the saline solution and EDTA groups. ( Fig. 3 and Fig. 4 ). Fig. 3 Representatives CLSM images of the S. mutans planktonic culture (×65 magnification), showing the non-photoactivated (left side) and photoactivated (right side) effects, after the following treatments: Saline solution (A–B); EDTA (C–D) and 0.2% chlorhexidine (E). Viable cells are green due to SYTO 9 staining and cells with damaged membranes are red due to propidium iodide staining (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.). Fig. 4 Representatives confocal laser scanning microscopy images of the S. mutans planktonic culture (×65 magnification), showing the non-photoactivated (left side) and photoactivated (right side) effects, after the following treatments: 50 μM curcumin (A–B); 500 μM curcumin (C–D); 50 μM curcumin + EDTA (E–F) and 500 μM curcumin + EDTA (G–H). Viable cells are green due to SYTO 9 staining and cells with damaged membranes are red due to propidium iodide staining (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.). Visualization of the ultrastructure morphology of curcumin-treated S. mutans was performed by TEM and the representative microscopic images are shown in Figs. 5, 6 and 7 . Saline solution and EDTA groups treated with blue light or not exhibited regular bacterial morphology, without visible changes on their structures ( Fig. 5 A–D). Fig. 5 E and F show that 50 μM curcumin-treated S. mutans presented morphological changes, including vacuoles formation and irregularities on the cell membrane, that increased with light irradiation. Also, precipitation of curcumin particles was found in the medium. The treatment with 500 μM curcumin and light exposure ( Fig. 6 A and B) also produced vacuoles formation; nevertheless, alterations on the cell membrane were less evident, and precipitation of curcumin particles increased. Fig. 5 Representative TEM micrographs of the S. mutans ultrastructure (×40 K magnification), showing the non-photoactivated (left side) and photoactivated (right side) effects, after the following treatments: Saline solution (A–B); EDTA (C–D) and 0.2% chlorhexidine (E). Fig. 6 Representative TEM micrographs of the S. mutans ultrastructure (×40,000 magnification), showing the non-photoactivated (left side) and photoactivated (right side) effects, after the following treatments: 50 μM curcumin (A–B); 500 μM curcumin (C–D); 50 μM curcumin + 0.4% EDTA (E–F) and 500 μM curcumin + 0.4% EDTA (G–H). Note the presence of vacuoles on the groups treated with curcumin and light (Pointer). Open arrow indicates curcumin particles, black arrows indicate alterations on the form of the cellular membrane and the asterisks indicate membrane rupture. Fig. 7 Representative TEM micrograph of Curcumin aggregates observed at the 500 μM curcumin solution (A); and the S. mutans ultrastructure (×80,000 magnification), showing the presence of curcumin aggregates on the surface of the membrane on the groups treated with curcumin 500 μM (B, Pointer). The combination of curcumin and EDTA produced different results depending on the curcumin concentration and light exposure. For the non-irradiated groups, alterations on the cells were less evident. For the blue light-treated groups, the combination of 50 μM curcumin and EDTA produced vacuoles formation, deformation and rupture on cell membrane. For the 500 μM curcumin and EDTA group, vacuoles formation was reduced, and a greater precipitation of curcumin particles was observed. Notoriously, all the groups treated with 500 μM curcumin presented curcumin aggregates on the cell membrane ( Fig. 7 B). Finally, the culture treated with 0.2% chlorhexidine showed bacteria with alterations in the wall membrane. Chlorhexidine did not disrupt the bacteria and the integrity of the bacteria remained intact. The DNA damage was also investigated by performing PCR and the Fig. 8 represents the PCR-amplified products of each experimental groups. PCR results showed no noticeable differences between the experimental groups. Thus, the curcumin-mediated photodynamic inactivation with or without EDTA against S. mutans did not result in DNA damage. Fig. 8 PCR gel electrophoresis showing 16S rRNA gene bands (at 1401 bp) of the experimental groups. Line L: Gel Loading Dye, Purple (6×), DNA leader. Abbreviations: bp (base pairs), L (leader), 1 (Saline solution), 2 (0.2% Chlorhexidine), 3 (Saline solution + Photoactivation), 4 (0.4% EDTA), 5 (50 μM curcumin), 6 (50 μM curcumin + Photoactivation), 7 (0.4% EDTA + Photoactivation), 8 (50 μM curcumin + 0.4% EDTA), 9 (50 μM curcumin + 0.4% EDTA + Photoactivation), 10 (500 μM curcumin), 11 (500 μM curcumin + Photoactivation), 12 (500 μM curcumin + 0.4% EDTA), and 13 (500 μM curcumin + 0.4% EDTA + Photoactivation). 4 Discussion This study clearly demonstrates the efficacy of curcumin-mediated PDI with or without EDTA using a blue light source on the planktonic culture of S. mutans. In this study, special attention was given to the protocol of the light exposure by the blue light device during the photoactivation. This optimization reduced the application time, compared with other studies, reaching clinically acceptable times. Moreover, the combination of curcumin and EDTA was effective and produced a synergistic effect potentiating the treatment efficacy. The MIC and MBC values for curcumin and EDTA showed weaker antibacterial activity against S. mutans . The MIC for curcumin in previous study ranked between 125 μM to 375 μM against S. mutans [ ], those values are lower to the MIC obtained in this study. Different methodologies and experimental designs used by those investigations could explain the variations of the results. On the other hand, the results showed that EDTA has bactericide activity against S. mutans , which seems new information to the field. Previous studies on other strains have showed antibacterial efficacy of the EDTA against Gram negative bacteria, attributed to its capability to sequester divalent ions of the bacterial membrane [ , , ]. The combination curcumin/EDTA was synergistic against S. mutans for all the ratios tested, with a higher effect for the 9:1 curcumin/EDTA ratio ( Table 2 and Fig. 2 ). These results suggest that EDTA facilitates the access of curcumin trough the bacterial membrane. Combinations of EDTA with antibiotics and photosensitizers have already been tested, and synergistic interactions have been reported [ , , ]. As a Gram-positive bacterium, S. mutans is more resistant to the EDTA due to the composition on its membrane. However, the potentiation of antimicrobial activity of curcumin by the EDTA against S. mutans , obtained in this study could be explained by the chelation of the magnesium and manganese cations. These cations are essentials for the initial biosynthesis of the bacterial peptidoglycans [ ]. These findings reject the first null hypothesis that curcumin/EDTA combination would not have a synergic antibacterial effect. The results confirm that curcumin (50 μM or 500 μM) in combination with blue light is effective to completely inactivate S. mutans in planktonic suspension ( Table 3 ). All the curcumin concentration regardless the combination with EDTA resulted in complete eradication of S. mutans. The results of viable colony counts showed no antibacterial effect when curcumin was used in absence of blue light confirming its mechanism of action based on the ROS production. Previous studies have demonstrated the antimicrobial activity of PDI with curcumin [ , , ]. However, large variation in the application protocols was observed, despite using the same photosensitizer and light source, as well as great diversity on the irradiation protocols (time, power, and irradiance) and in the photosensitizer concentration were found [ , ], for those reasons, comparison between results is discouraged. Therefore, the second hypothesis stating that curcumin-EDTA mediated PDI would not have an antibacterial effect was rejected. The performance of PDI can be affected by the light source and the energy delivered. In this study, special attention was given to these two aspects to improve the performance of PDI with curcumin. Since curcumin mainly absorbs light within the wavelength range of 400 and 500 nm [ , ], a polywave LED blue light unit with two peak lights (409 and 456 nm) was selected. The use of a polywave LED unit produced a greater exposure on the spectral absorption range of curcumin, allowing an efficient activation of the photosensitizer. To improve the amount of energy delivered by the light source, a careful review of previous studies using blue light was performed. The light energy used by other studies was between 9 and 200 J/cm 2 [ ] with exposure times up to 32 min [ ]. Based on this and as explained above, the proposed protocol delivered 33.5 J/cm 2 of energy at 1 mm distance. The introduction of these improvements allowed reducing the photoactivation time to 40 s, which is a clinically reasonable, commonly used time. Therefore, the optimization of the light curing source and energy delivered allowed to use the dental curing light for PDI, without the need to invest in new equipment. The Live/Dead assay confirms the effectiveness of curcumin-mediated PDI. Nonetheless, in the non-photoactivated, curcumin treated groups, with or without EDTA, a significant increase on the non-viable cells was observed, which would seemingly contradict the results of VCC assay. Propidium iodide (PI) is a red fluorescent agent used to stain cells and nucleic acids that can pass through the membrane when it has been permeabilized or suffered some injure [ ]. Studies have reported that bacteria identified as non-viable may exhibit an intermediate state as a result of environmental stress [ ]. In our study, the intermediate state can be the result of an increase in the membrane permeability mediated by curcumin, allowing the penetration of PI. Previous studies report that cells with compromised integrity can recover their viability when returned to a favorable environment [ , ]. Based on the VCC results, the cells identified as non-viable in the groups treated with curcumin, were able to recover their viability. Also, because curcumin has a natural fluorescence (excitation (λ) = 430 nm, emission = 450–550 nm) [ ] that is close to SYTO 9 used in the live-dead kit of the CLSM, a background fluorescence of curcumin could be expected. To reduce the interference of curcumin in the CLSM observations, the samples were washed twice after treatment, to remove remaining curcumin. Nevertheless, despite the washing procedure, some curcumin aggregates were observed in the samples with higher curcumin concentrations ( Fig. 4 ). The presence of curcumin aggregates in the light-activated groups, demonstrates that curcumin did not react properly when it formed aggregates. These findings partially explain why curcumin was more efficient to inactivate bacteria and induce structural damage at lower concentrations. The TEM images ( Figs. 5 and 6 ) demonstrate the alterations in the bacterial structure after curcumin-mediated PDI treated with EDTA, however the effects on the S. mutans ultrastructure were different for all groups. The groups with EDTA,exhibited evident damage on the bacterial structure, that was remarkable for the group treated with 50 μM curcumin, 0.4% EDTA, and irradiated with blue light. Interestingly, the use of 500 μM curcumin did not result in the same cellular damage. Thus, the third hypothesis that states that curcumin-EDTA mediated PDI would not have a significant effect on the cellular integrity of S. mutans in planktonic suspension was rejected. Based on the results, the damage on the S. mutans is dependent on the concentration and the combination or not with EDTA. As reported previously, the effectivity of curcumin decreased at higher concentrations [ ]. Similar results were found by Lee et al., which observed 100% bacterial inactivation with concentrations between 10 ng/mL and 10 3 ng/mL but reported only 10% reduction with a concentration of 10 4 ng/mL. According to the authors, it could be a result of incomplete dissolution of curcumin in the medium ( Fig. 7 ), impeding the interaction with light [ ]. In this study, the use 50 μM curcumin and blue light produced a strong effect on bacterial structure. It was observed vacuoles formations inside bacteria ( Fig. 6 ) and the effect was enhanced with EDTA treatment ( Fig. 6 ). On the contrary, the use of 500 μM curcumin was ineffective and resulted in less vacuole formation and no alteration in the cell membrane ( Fig. 6 ). Additionally, in the groups treated with 500 μM curcumin, TEM images revealed the presence of curcumin aggregates outside the cell wall ( Fig. 7 B). The formation of curcumin aggregates is consequence of the hydrophobicity of the compound. Curcumin particles stack together to minimize contact with water, forming clusters driven by hydrophobic forces [ ]. This phenomenon has been described as aggregation-caused quenching, and it results in quenched fluorescence and reduced ROS generation [ ], reducing the photodynamic effects of curcumin. Other authors have reported that high photosensitizer concentrations could difficult diffusion of the light through the solution, causing an optical quenching [ , ]. The CLSM images confirm these assumptions, because agglomerates of non-reacted curcumin were observed even after photoactivation especially in the groups treated with 500 μM curcumin ( Figs. 3–6 ). Although the synergism between EDTA and other photosensitizers has been reported previously; however, its action mechanism remains unclear. In this study, it was considered that the synergistic effect resulted from differences in cellular penetration, for the chelation of some ions as explained above. TEM imagens showed that presence of a high number of curcumin particles in the cytoplasm was more noticeable in the EDTA treated groups ( Fig. 6 ). The results imply that EDTA can alter the permeability of the cell wall, allowingefficient penetration of curcumin on the bacteria structure [ ]. The effect of curcumin-mediated PDI with EDTA on the genomic DNA was also evaluated by PCR. The results showed that the proposed treatment did not result in significant DNA damage ( Fig. 8 ). Thus, the fourth hypothesis stating that curcumin-EDTA mediated PDT would not produce DNA damage against S. mutans in planktonic suspension was accepted. As stated earlier, the mechanism of action on the PDI is based on ROS generation where the singlet oxygen is considered the more important [ , ]. Singlet oxygen is capable to penetrate into the cell, degrade the membrane cell, and the nucleic acids [ ]. However, when compared with other photosensitizers curcumin has a lower quantum yield of radicals [ ]. In general, photosensitizers irradiated by blue light sources produce lower amount of ROS than other red light activated photosensitizers [ ]. The lower quantum yield of radicals explains why curcumin did not affect the DNA structure on S. mutans . However, a recent study show that curcumin can induce DNA damage on Candida albicans [ ]. This study confirms that damage of the membrane is a key mechanism of curcumin action, without damaging the DNA structure, although the radical generation promoted by the ROS without a specific target structure or metabolic pathway, reducingthe risk to develop bacterial resistance [ , ]. Regarding the experimental design, several studies have shown that the S. mutans is susceptible to the action of the PDI, and therefore the evaluation of the novel treatment on a planktonic culture of S. mutans is the first step to establish a protocol, despite methodological limitations. However, dental caries results from the formation of a biofilm, that tends to minimize the effectiveness of PDI, because the biofilm structure reduces the penetrability of curcumin into the bacteria, therefore further studies using S. mutans biofilm are required to confirm the effectiveness of PDI with the curcumin-EDTA combination. 5 Conclusions The combination of curcumin/EDTA was synergistic against S. mutans . Blue light activated, curcumin-mediated, PDI with or without EDTA, was effective to inactivate S. mutans in planktonic suspension. Based on the TEM observation, the combination of low concentration (50 μM) curcumin and EDTA produces significant alterations on the bacteria ultrastructure. However, no damage of the genomic DNA was observed. Our results showed that curcumin-mediated PDI with EDTA could be a promising technique to reduce S. mutans viability, without the problems of the disinfecting agents. Acknowledgment This work was used by GN as partial fulfillment of the requirements to obtain the PhD degree in Dental Materials and as part of his PhD thesis. This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES) - Finance Code 001 and supported by Research CAPES Grant 878-2018 . The authors want to thank Dr. Carlos Shimokawa for his help in the light curing device characterization and Dr. Flavia Sammartino Mariano for assistance with the obtention microscopy images. CLSM and TEM images were obtained at the Center of Microscopy and Image (CMI), Piracicaba Dental School – UNICAMP. References 1. Matsumoto-Nakano M.: Role of Streptococcus mutans surface proteins for biofilm formation. Jpn Dent Sci Rev 2018; 54: pp. 22-29. 2. Loesche W.J.: Role of Streptococcus mutans in human dental decay. Microbiol Rev 1986; 50: pp. 353-380. 3. Banas J.A., Vickerman M.M.: Glucan-binding proteins of the oral streptococci. Crit Rev Oral Biol Med 2003; 14: pp. 89-99. 4. Xiao J., Koo H.: Structural organization and dynamics of exopolysaccharide matrix and microcolonies formation by Streptococcus mutans in biofilms. J Appl Microbiol 2009; 108: pp. 2103-2113. 5. Schwendicke F., Frencken J.E., Bjørndal L., Maltz M., Manton D.J., Ricketts D., et. al.: Managing carious lesions. Adv Dent Res 2016; 28: pp. 58-67. 6. Gurgan S., Bolay S., Kiremitci A.: Effect of disinfectant application methods on the bond strength of composite to dentin. J Oral Rehabil 1999; 26: pp. 836-840. 7. Comba A., Maravic T., Valente L., Girlando M., Cunha S.R., Checchi V., et. al.: Effect of benzalkonium chloride on dentin bond strength and endogenous enzymatic activity. J Dent 2019; 85: pp. 25-32. 8. Salama F., Balto H., Al-Yahya F., Al-Mofareh S.: The effect of cavity disinfectants on microleakage of composite restorations in primary teeth. Eur J Paediatr Dent 2015; 16: pp. 295-300. 9. Kim M., Weigand M.R., Oh S., Hatt J.K., Krishnan R., Tezel U., et. al.: Widely used benzalkonium chloride disinfectants can promote antibiotic resistance. Appl Environ Microbiol 2018; pp. 84. 10. Kampf G.: Acquired resistance to chlorhexidine - is it time to establish an “antiseptic stewardship” initiative?. J Hosp Infect 2016; 94: pp. 213-227. 11. Delben J.A., Zago C.E., Tyhovych N., Duarte S., Vergani C.E.: Effect of atmospheric-pressure cold plasma on pathogenic oral biofilms and in vitro reconstituted oral epithelium. PLoS One 2016; 11: 12. Nagata J.Y., Hioka N., Kimura E., Batistela V.R., Terada R.S.S., Graciano A.X., et. al.: Antibacterial photodynamic therapy for dental caries: evaluation of the photosensitizers used and light source properties. Photodiagnosis Photodyn Ther 2012; 9: pp. 122-131. 13. Liu Y., Qin R., Zaat S.A.J., Breukink E., Heger M.: Antibacterial photodynamic therapy: overview of a promising approach to fight antibiotic-resistant bacterial infections. J Clin Transl Res 2015; 1: pp. 140-167. 14. Kwiatkowski S., Knap B., Przystupski D., Saczko J., Kędzierska E., Knap-Czop K., et. al.: Photodynamic therapy – mechanisms, photosensitizers and combinations. Biomed Pharmacother 2018; 106: pp. 1098-1107. 15. Cieplik F., Tabenski L., Buchalla W., Maisch T.: Antimicrobial photodynamic therapy for inactivation of biofilms formed by oral key pathogens. Front Microbiol 2014; pp. 5. 16. Saitawee D., Teerakapong A., Morales N.P., Jitprasertwong P., Hormdee D.: Photodynamic therapy of Curcuma longa extract stimulated with blue light against Aggregatibacter actinomycetemcomitans. Photodiagnosis Photodyn Ther 2018; 22: pp. 101-105. 17. Koshi E., Mohan A., Rajesh S., Philip K.: Antimicrobial photodynamic therapy: an overview. J Indian Soc Periodontol 2011; 15: pp. 323. 18. Lee Y.-H., Park H.-W., Lee J.-H., Seo H.-W., Lee S.-Y.: The photodynamic therapy on Streptococcus mutans biofilms using erythrosine and dental halogen curing unit. Int J Oral Sci 2012; 4: pp. 196-201. 19. Gunes H., Gulen D., Mutlu R., Gumus A., Tas T., Topkaya A.E.: Antibacterial effects of curcumin: an in vitro minimum inhibitory concentration study. Toxicol Ind Health 2016; 32: pp. 246-250. 20. Tsuda T.: Curcumin as a functional food-derived factor: degradation products, metabolites, bioactivity, and future perspectives. Food Funct 2018; 9: pp. 705-714. 21. Azizi A., Shohrati P., Goudarzi M., Lawaf S., Rahimi A.: Comparison of the effect of photodynamic therapy with curcumin and methylene Blue on streptococcus mutans bacterial colonies. Photodiagnosis Photodyn Ther 2019; 27: pp. 203-209. 22. Leite D.P.V., Paolillo F.R., Parmesano T.N., Fontana C.R., Bagnato V.S.: Effects of photodynamic therapy with blue light and curcumin as mouth rinse for oral disinfection: a randomized controlled trial. Photomed Laser Surg 2014; 32: pp. 627-632. 23. Umerska A., Strandh M., Cassisa V., Matougui N., Eveillard M., Saulnier P.: Synergistic effect of combinations containing EDTA and the antimicrobial peptide AA230, an arenicin-3 derivative, on gram-negative bacteria. Biomolecules 2018; 8: pp. 122. 24. Hamoud R., Zimmermann S., Reichling J., Wink M.: Synergistic interactions in two-drug and three-drug combinations (thymol, EDTA and vancomycin) against multi drug resistant bacteria including E. Coli. Phytomedicine 2014; 21: pp. 443-447. 25. Hamoud R., Reichling J., Wink M.: Synergistic antibacterial activity of the combination of the alkaloid sanguinarine with EDTA and the antibiotic streptomycin against multidrug resistant bacteria. J Pharm Pharmacol 2015; 67: pp. 264-273. 26. Hu J., Lin S., Tan B.K., Hamzah S.S., Lin Y., Kong Z., et. al.: Photodynamic inactivation of Burkholderia cepacia by curcumin in combination with EDTA. Food Res Int 2018; 111: pp. 265-271. 27. Banin E., Brady K.M., Greenberg E.P.: Chelator-induced dispersal and killing of Pseudomonas aeruginosa cells in a biofilm. Appl Environ Microbiol 2006; 72: pp. 2064-2069. 28. Maisch T., Wagner J., Papastamou V., Nerl H.J., Hiller K.A., Szeimies R.M., et. al.: Combination of 10% EDTA, Photosan, and a blue light hand-held photopolymerizer to inactivate leading oral bacteria in dentistry in vitro. J Appl Microbiol 2009; 107: pp. 1569-1578. 29. Méndez D.A.C., Gutierrez E., Dionísio E.J., Oliveira T.M., Buzalaf M.A.R., Rios D., et. al.: Effect of methylene blue-mediated antimicrobial photodynamic therapy on dentin caries microcosms. Lasers Med Sci 2018; 33: pp. 479-487. 30. Elshikh M., Ahmed S., Funston S., Dunlop P., McGaw M., Marchant R., et. al.: Resazurin-based 96-well plate microdilution method for the determination of minimum inhibitory concentration of biosurfactants. Biotechnol Lett 2016; 38: pp. 1015-1019. 31. Van Vuuren S.F., Suliman S., Viljoen A.M.: The antimicrobial activity of four commercial essential oils in combination with conventional antimicrobials. Lett Appl Microbiol 2009; 48: pp. 440-446. 32. Berenbaum M.C.: A method for testing for synergy with any number of agents. J Infect Dis 1978; 137: pp. 122-130. 33. Lee D.-W., Jung J.-E., Yang Y.-M., Kim J.-G., Yi H.-K., Jeon J.-G.: The antibacterial activity of chlorhexidine digluconate against Streptococcus mutans biofilms follows sigmoidal patterns. Eur J Oral Sci 2016; 124: pp. 440-446. 34. Wright M.H., Adelskov J., Greene A.C.: Bacterial DNA extraction using individual enzymes and Phenol/Chloroform separation †. J Microbiol Biol Educ 2017; 18: pp. 1-3. 35. Hu P., Huang P., Chen M.W.: Curcumin reduces Streptococcus mutans biofilm formation by inhibiting sortase A activity. Arch Oral Biol 2013; 58: pp. 1343-1348. 36. Li B., Li X., Lin H., Zhou Y.: . Biomed Res Int 2018; 2018: pp. 1-11. 37. Song J., Choi B., Jin E.J., Yoon Y., Choi K.H.: . Eur J Clin Microbiol Infect Dis 2012; 31: pp. 1347-1352. 38. Pelletier C., Bourlioux P., van Heijenoort J.: Effects of sub-minimal inhibitory concentrations of EDTA on growth of Escherichia coli and the release of lipopolysaccharide. FEMS Microbiol Lett 1994; 117: pp. 203-206. 39. Al-Bakri A.G., Othman G., Bustanji Y.: The assessment of the antibacterial and antifungal activities of aspirin, EDTA and aspirin-EDTA combination and their effectiveness as antibiofilm agents. J Appl Microbiol 2009; 107: pp. 280-286. 40. Farca A.M., Nebbia P., Re G.: Potentiation of antibiotic activity by EDTA-tromethamine against three clinically isolated Gram-positive resistant bacteria. Anin vitro investigation. Vet Res Commun 1994; 18: pp. 1-6. 41. Lee H.J., Kang S.M., Jeong S.H., Chung K.H., Kim B.I.: Antibacterial photodynamic therapy with curcumin and Curcuma xanthorrhiza extract against Streptococcus mutans. Photodiagnosis Photodyn Ther 2017; 20: pp. 116-119. 42. Paschoal M.A., Tonon C.C., Spolidório D.M.P., Bagnato V.S., Giusti J.S.M., Santos-Pinto L.: . Photodiagnosis Photodyn Ther 2013; 10: pp. 313-319. 43. Manoil D., Filieri A., Gameiro C., Lange N., Schrenzel J., Wataha J.C., et. al.: . Photodiagnosis Photodyn Ther 2014; 11: pp. 372-379. 44. Méndez D.A.C., Rizzato V.L., Lamarque G.C.C., Dionisio E.J., Buzalaf M.A.R., Rios D., et. al.: Could a chelant improve the effect of curcumin-mediated photodynamic antimicrobial chemotherapy against dental intact biofilms?. Lasers Med Sci 2019; 34: pp. 1185-1192. 45. Tyagi P., Singh M., Kumari H., Kumari A., Mukhopadhyay K.: Bactericidal activity of curcumin I is associated with damaging of bacterial membrane. PLoS One 2015; 10: pp. 1-15. 46. Van Impe J., Smet C., Tiwari B., Greiner R., Ojha S., Stulić V., et. al.: State of the art of nonthermal and thermal processing for inactivation of micro-organisms. J Appl Microbiol 2018; 125: pp. 16-35. 47. Muñoz M., Guevara L., Palop A., Tabera J., Fernández P.S.: Determination of the effect of plant essential oils obtained by supercritical fluid extraction on the growth and viability of Listeria monocytogenes in broth and food systems using flow cytometry. LWT - Food Sci Technol 2009; 42: pp. 220-227. 48. Chignell C.F., Bilskj P., Reszka K.J., Motten A.G., Sik R.H., Dahl T.A.: Spectral and photochemical properties of curcumin. Photochem Photobiol 1994; 59: pp. 295-302. 49. Cozzolino M., Delcanale P., Montali C., Tognolini M., Giorgio C., Corrado M., et. al.: Enhanced photosensitizing properties of protein bound curcumin. Life Sci 2019; 233: 50. Khopde S.M., Indira Priyadarsini K., Palit D.K., Mukherjee T.: Effect of solvent on the excited-state photophysical properties of curcumin. Photochem Photobiol 2000; 72: pp. 625. 51. Qi J., Hu X., Dong X., Lu Y., Lu H., Zhao W., et. al.: Towards more accurate bioimaging of drug nanocarriers: turning aggregation-caused quenching into a useful tool. Adv Drug Deliv Rev 2019; 143: pp. 206-225. 52. Luo C., Sun B., Wang C., Zhang X., Chen Y., Chen Q., et. al.: Self-facilitated ROS-responsive nanoassembly of heterotypic dimer for synergistic chemo-photodynamic therapy. J Control Release 2019; 302: pp. 79-89. 53. Gao Y., Zheng Q.C., Xu S., Yuan Y., Cheng X., Jiang S., et. al.: Theranostic nanodots with aggregation-induced emission characteristic for targeted and image-guided photodynamic therapy of hepatocellular carcinoma. Theranostics 2019; 9: pp. 1264-1279. 54. Paschoal M.A., Santos-Pinto L., Lin M., Duarte S.: Streptococcus mutans photoinactivation by combination of short exposure of a broad-spectrum visible light and low concentrations of photosensitizers. Photomed Laser Surg 2014; 32: pp. 175-180. 55. Vaara M.: Agents that increase the permeability of the outer membrane. Microbiol Rev 1992; 56: pp. 395-411. 56. Misba L., Zaidi S., Khan A.U.: Efficacy of photodynamic therapy against Streptococcus mutans biofilm: role of singlet oxygen. J Photochem Photobiol B, Biol 2018; 183: pp. 16-21. 57. Wood S., Metcalf D., Devine D., Robinson C.: Erythrosine is a potential photosensitizer for the photodynamic therapy of oral plaque biofilms. J Antimicrob Chemother 2006; 57: pp. 680-684. 58. Carmello J.C., Pavarina A.C., Oliveira R., Johansson B.: Genotoxic effect of photodynamic therapy mediated by curcumin on Candida albicans. FEMS Yeast Res 2015; pp. 15. 59. Florez F.L., Arco M.C., Salvador S.L., Bagnato V.S., Junior O.B.: Viability study of antimicrobial photodynamic therapy using curcumin, hypericin and photogem photosensitizers in planktonic cells of Streptococcus mutans. Sci J Dent 2015; 2: pp. 22-27. https://doi.org/10.15713/ins.sjod.18

Related Articles

Leave A Comment?

You must be logged in to post a comment.